Incidental Mutation 'R7678:Tbkbp1'
ID592595
Institutional Source Beutler Lab
Gene Symbol Tbkbp1
Ensembl Gene ENSMUSG00000038517
Gene NameTBK1 binding protein 1
Synonyms3110043L15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7678 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location97136171-97151495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97149483 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 35 (D35G)
Ref Sequence ENSEMBL: ENSMUSP00000114460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066078] [ENSMUST00000107613] [ENSMUST00000107614] [ENSMUST00000107615] [ENSMUST00000118375] [ENSMUST00000146374]
Predicted Effect probably damaging
Transcript: ENSMUST00000066078
AA Change: D35G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000065461
Gene: ENSMUSG00000038517
AA Change: D35G

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 156 N/A INTRINSIC
low complexity region 168 173 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
coiled coil region 218 278 N/A INTRINSIC
Pfam:TBD 287 342 2.8e-24 PFAM
low complexity region 343 432 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107613
AA Change: D35G

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103238
Gene: ENSMUSG00000038517
AA Change: D35G

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 152 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107614
AA Change: D35G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103239
Gene: ENSMUSG00000038517
AA Change: D35G

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 156 N/A INTRINSIC
low complexity region 168 173 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
coiled coil region 218 278 N/A INTRINSIC
Pfam:TBD 289 343 4.1e-21 PFAM
low complexity region 460 477 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107615
AA Change: D35G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103240
Gene: ENSMUSG00000038517
AA Change: D35G

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 156 N/A INTRINSIC
low complexity region 168 173 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
coiled coil region 217 277 N/A INTRINSIC
Pfam:TBD 286 341 4e-25 PFAM
low complexity region 342 431 N/A INTRINSIC
low complexity region 459 476 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118375
AA Change: D35G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112396
Gene: ENSMUSG00000038517
AA Change: D35G

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 156 N/A INTRINSIC
low complexity region 168 173 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
coiled coil region 217 277 N/A INTRINSIC
Pfam:TBD 286 341 4e-25 PFAM
low complexity region 342 431 N/A INTRINSIC
low complexity region 459 476 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146374
AA Change: D35G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114460
Gene: ENSMUSG00000038517
AA Change: D35G

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 145 N/A INTRINSIC
Meta Mutation Damage Score 0.4891 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TBKBP1 is an adaptor protein that binds to TBK1 (MIM 604834) and is part of the interaction network in the TNF (MIM 191160)/NFKB (see MIM 164011) pathway (Bouwmeester et al., 2004 [PubMed 14743216]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal GM-CSF-derived bone marrow-derived dendritic cell differentiation and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C A 5: 8,087,750 probably null Het
Ank1 A G 8: 23,117,058 D1325G probably damaging Het
Asxl1 T C 2: 153,400,652 S1042P probably damaging Het
Bpifb1 C T 2: 154,202,729 H39Y possibly damaging Het
Capn13 C A 17: 73,315,305 M663I probably damaging Het
Clec2g A G 6: 128,979,437 E72G probably damaging Het
Col12a1 T A 9: 79,651,486 Y1899F probably damaging Het
Ctbp2 A G 7: 133,014,624 V194A probably benign Het
Cttnbp2 G T 6: 18,382,810 L1320I probably damaging Het
E2f2 T A 4: 136,192,826 L374* probably null Het
Echdc3 C T 2: 6,212,876 G29S probably benign Het
Ecm1 A G 3: 95,736,182 S269P probably damaging Het
Elmo2 G A 2: 165,291,744 P775S unknown Het
Eno3 T A 11: 70,659,167 probably null Het
Faf1 G A 4: 109,829,864 R267K probably benign Het
Fam162a G A 16: 36,049,937 probably benign Het
Fam178b T A 1: 36,564,451 D473V probably damaging Het
Fat2 G A 11: 55,282,330 T2519I probably damaging Het
Foxc2 A G 8: 121,118,095 Y494C probably damaging Het
Gcnt2 C A 13: 40,953,719 Q355K probably benign Het
Glg1 G T 8: 111,178,865 H595N probably benign Het
Gm9913 A T 2: 125,506,560 H97L unknown Het
Hbegf T A 18: 36,507,548 N152I possibly damaging Het
Hipk1 G A 3: 103,760,550 T567I probably damaging Het
Idh3a C T 9: 54,595,169 P78S probably damaging Het
Igsf10 A T 3: 59,319,340 M2304K possibly damaging Het
Inf2 A G 12: 112,606,994 T723A unknown Het
Itpr2 A T 6: 146,187,550 F2220Y probably benign Het
Kpnb1 C T 11: 97,169,173 R557Q probably damaging Het
Lefty1 A G 1: 180,936,760 D155G probably damaging Het
Lrp1 A G 10: 127,574,053 C1554R probably damaging Het
Lrrc10 A G 10: 117,045,757 D112G probably benign Het
Med12l A G 3: 59,076,720 E439G probably damaging Het
Ms4a7 A T 19: 11,324,504 F185Y probably benign Het
Mtmr6 T A 14: 60,289,652 M234K probably damaging Het
Myh7b C A 2: 155,617,778 probably null Het
Myo1d T C 11: 80,676,893 M254V possibly damaging Het
Nbas T C 12: 13,415,661 V1368A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Neb A G 2: 52,206,702 V4999A probably damaging Het
Npbwr1 G T 1: 5,916,708 Q196K probably benign Het
Nsd3 A T 8: 25,659,817 E339D possibly damaging Het
Olfr738 T C 14: 50,414,014 F157L probably damaging Het
Olfr776 A G 10: 129,261,068 S36G probably damaging Het
Olfr867 T C 9: 20,054,605 N168S probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna1 C T 6: 89,331,900 V1199M probably damaging Het
Ppfibp2 T A 7: 107,716,666 M285K probably damaging Het
Ppip5k1 A G 2: 121,337,661 Y704H probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sbspon T C 1: 15,859,058 M170V probably benign Het
Scfd2 A C 5: 74,458,636 F440V probably benign Het
Slc22a19 T A 19: 7,710,937 D86V possibly damaging Het
Smg5 A G 3: 88,353,895 N685S possibly damaging Het
Spata46 A G 1: 170,311,764 R111G possibly damaging Het
Sry A T Y: 2,663,248 D137E possibly damaging Het
Tcf20 A T 15: 82,851,565 V1895D possibly damaging Het
Tfap4 G T 16: 4,551,766 Q112K possibly damaging Het
Tmem2 C A 19: 21,798,116 T241K probably damaging Het
Trmt10c T A 16: 56,034,939 D111V probably benign Het
Unc80 T C 1: 66,649,722 I2415T probably benign Het
Vmn2r107 A T 17: 20,356,639 M300L probably benign Het
Vmn2r5 A T 3: 64,509,522 F72I probably benign Het
Vmn2r53 T A 7: 12,598,498 H408L probably benign Het
Zan C T 5: 137,463,540 V1126M unknown Het
Zfp493 A T 13: 67,779,695 probably benign Het
Zfp618 C A 4: 63,086,621 A86E probably benign Het
Other mutations in Tbkbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Tbkbp1 APN 11 97137648 unclassified probably benign
IGL01071:Tbkbp1 APN 11 97149562 missense probably damaging 0.99
R0017:Tbkbp1 UTSW 11 97146289 unclassified probably benign
R0445:Tbkbp1 UTSW 11 97149469 missense probably damaging 1.00
R1468:Tbkbp1 UTSW 11 97148988 missense probably damaging 1.00
R1468:Tbkbp1 UTSW 11 97148988 missense probably damaging 1.00
R4198:Tbkbp1 UTSW 11 97149068 critical splice acceptor site probably null
R4737:Tbkbp1 UTSW 11 97148648 missense probably damaging 1.00
R4816:Tbkbp1 UTSW 11 97138741 missense probably benign 0.23
R4910:Tbkbp1 UTSW 11 97139130 missense probably benign 0.23
R4947:Tbkbp1 UTSW 11 97138944 utr 3 prime probably benign
R5571:Tbkbp1 UTSW 11 97148729 missense probably damaging 1.00
R6083:Tbkbp1 UTSW 11 97147380 missense probably damaging 1.00
R6207:Tbkbp1 UTSW 11 97146339 missense probably damaging 1.00
R6595:Tbkbp1 UTSW 11 97138752 utr 3 prime probably benign
R7684:Tbkbp1 UTSW 11 97147733 unclassified probably benign
R8425:Tbkbp1 UTSW 11 97138851 missense unknown
X0020:Tbkbp1 UTSW 11 97148974 missense probably damaging 0.99
Z1176:Tbkbp1 UTSW 11 97149528 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CAAGGCAGCCACTTCTTCAG -3'
(R):5'- AGCAGGTGGTCCTCTTTACTCTG -3'

Sequencing Primer
(F):5'- ACTTCTTCAGGGACCAGGCAG -3'
(R):5'- ACTCTGTTCCTGCACTCTCAG -3'
Posted On2019-11-12