Incidental Mutation 'R7678:Capn13'
ID592608
Institutional Source Beutler Lab
Gene Symbol Capn13
Ensembl Gene ENSMUSG00000043705
Gene Namecalpain 13
SynonymsLOC381122
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R7678 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location73306464-73399296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73315305 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 663 (M663I)
Ref Sequence ENSEMBL: ENSMUSP00000092832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095208]
Predicted Effect probably damaging
Transcript: ENSMUST00000095208
AA Change: M663I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092832
Gene: ENSMUSG00000043705
AA Change: M663I

DomainStartEndE-ValueType
CysPc 12 337 3.23e-113 SMART
Pfam:Calpain_III 341 473 2e-13 PFAM
SCOP:d1k94a_ 512 664 3e-8 SMART
Meta Mutation Damage Score 0.2444 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes a member of the calpain large subunit family. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C A 5: 8,087,750 probably null Het
Ank1 A G 8: 23,117,058 D1325G probably damaging Het
Asxl1 T C 2: 153,400,652 S1042P probably damaging Het
Bpifb1 C T 2: 154,202,729 H39Y possibly damaging Het
Clec2g A G 6: 128,979,437 E72G probably damaging Het
Col12a1 T A 9: 79,651,486 Y1899F probably damaging Het
Ctbp2 A G 7: 133,014,624 V194A probably benign Het
Cttnbp2 G T 6: 18,382,810 L1320I probably damaging Het
E2f2 T A 4: 136,192,826 L374* probably null Het
Echdc3 C T 2: 6,212,876 G29S probably benign Het
Ecm1 A G 3: 95,736,182 S269P probably damaging Het
Elmo2 G A 2: 165,291,744 P775S unknown Het
Eno3 T A 11: 70,659,167 probably null Het
Faf1 G A 4: 109,829,864 R267K probably benign Het
Fam162a G A 16: 36,049,937 probably benign Het
Fam178b T A 1: 36,564,451 D473V probably damaging Het
Fat2 G A 11: 55,282,330 T2519I probably damaging Het
Foxc2 A G 8: 121,118,095 Y494C probably damaging Het
Gcnt2 C A 13: 40,953,719 Q355K probably benign Het
Glg1 G T 8: 111,178,865 H595N probably benign Het
Gm9913 A T 2: 125,506,560 H97L unknown Het
Hbegf T A 18: 36,507,548 N152I possibly damaging Het
Hipk1 G A 3: 103,760,550 T567I probably damaging Het
Idh3a C T 9: 54,595,169 P78S probably damaging Het
Igsf10 A T 3: 59,319,340 M2304K possibly damaging Het
Inf2 A G 12: 112,606,994 T723A unknown Het
Itpr2 A T 6: 146,187,550 F2220Y probably benign Het
Kpnb1 C T 11: 97,169,173 R557Q probably damaging Het
Lefty1 A G 1: 180,936,760 D155G probably damaging Het
Lrp1 A G 10: 127,574,053 C1554R probably damaging Het
Lrrc10 A G 10: 117,045,757 D112G probably benign Het
Med12l A G 3: 59,076,720 E439G probably damaging Het
Ms4a7 A T 19: 11,324,504 F185Y probably benign Het
Mtmr6 T A 14: 60,289,652 M234K probably damaging Het
Myh7b C A 2: 155,617,778 probably null Het
Myo1d T C 11: 80,676,893 M254V possibly damaging Het
Nbas T C 12: 13,415,661 V1368A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Neb A G 2: 52,206,702 V4999A probably damaging Het
Npbwr1 G T 1: 5,916,708 Q196K probably benign Het
Nsd3 A T 8: 25,659,817 E339D possibly damaging Het
Olfr738 T C 14: 50,414,014 F157L probably damaging Het
Olfr776 A G 10: 129,261,068 S36G probably damaging Het
Olfr867 T C 9: 20,054,605 N168S probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna1 C T 6: 89,331,900 V1199M probably damaging Het
Ppfibp2 T A 7: 107,716,666 M285K probably damaging Het
Ppip5k1 A G 2: 121,337,661 Y704H probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sbspon T C 1: 15,859,058 M170V probably benign Het
Scfd2 A C 5: 74,458,636 F440V probably benign Het
Slc22a19 T A 19: 7,710,937 D86V possibly damaging Het
Smg5 A G 3: 88,353,895 N685S possibly damaging Het
Spata46 A G 1: 170,311,764 R111G possibly damaging Het
Sry A T Y: 2,663,248 D137E possibly damaging Het
Tbkbp1 T C 11: 97,149,483 D35G probably damaging Het
Tcf20 A T 15: 82,851,565 V1895D possibly damaging Het
Tfap4 G T 16: 4,551,766 Q112K possibly damaging Het
Tmem2 C A 19: 21,798,116 T241K probably damaging Het
Trmt10c T A 16: 56,034,939 D111V probably benign Het
Unc80 T C 1: 66,649,722 I2415T probably benign Het
Vmn2r107 A T 17: 20,356,639 M300L probably benign Het
Vmn2r5 A T 3: 64,509,522 F72I probably benign Het
Vmn2r53 T A 7: 12,598,498 H408L probably benign Het
Zan C T 5: 137,463,540 V1126M unknown Het
Zfp493 A T 13: 67,779,695 probably benign Het
Zfp618 C A 4: 63,086,621 A86E probably benign Het
Other mutations in Capn13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Capn13 APN 17 73339425 missense possibly damaging 0.82
IGL01099:Capn13 APN 17 73351509 missense probably damaging 0.99
IGL01613:Capn13 APN 17 73331058 missense probably benign 0.07
IGL02215:Capn13 APN 17 73330998 missense probably damaging 1.00
IGL02403:Capn13 APN 17 73351426 missense possibly damaging 0.82
IGL02877:Capn13 APN 17 73322055 missense probably damaging 0.97
IGL03113:Capn13 APN 17 73331113 missense probably benign 0.00
IGL03246:Capn13 APN 17 73382860 missense probably benign
IGL03369:Capn13 APN 17 73341154 splice site probably benign
R0116:Capn13 UTSW 17 73351524 missense probably damaging 1.00
R0729:Capn13 UTSW 17 73322069 missense probably damaging 1.00
R0745:Capn13 UTSW 17 73351508 missense probably benign 0.39
R0746:Capn13 UTSW 17 73351508 missense probably benign 0.39
R0778:Capn13 UTSW 17 73351508 missense probably benign 0.39
R1252:Capn13 UTSW 17 73367227 missense possibly damaging 0.80
R1594:Capn13 UTSW 17 73351479 missense probably benign 0.15
R1641:Capn13 UTSW 17 73382894 missense possibly damaging 0.91
R1895:Capn13 UTSW 17 73350525 missense possibly damaging 0.50
R1902:Capn13 UTSW 17 73326361 missense probably damaging 1.00
R1946:Capn13 UTSW 17 73350525 missense possibly damaging 0.50
R2184:Capn13 UTSW 17 73365948 missense probably damaging 1.00
R2427:Capn13 UTSW 17 73326317 splice site probably benign
R2963:Capn13 UTSW 17 73315263 critical splice donor site probably null
R3755:Capn13 UTSW 17 73331119 nonsense probably null
R3759:Capn13 UTSW 17 73322077 missense probably benign 0.01
R3795:Capn13 UTSW 17 73337392 missense probably benign 0.14
R3801:Capn13 UTSW 17 73339401 missense probably benign 0.00
R3802:Capn13 UTSW 17 73339401 missense probably benign 0.00
R3803:Capn13 UTSW 17 73339401 missense probably benign 0.00
R3804:Capn13 UTSW 17 73339401 missense probably benign 0.00
R4084:Capn13 UTSW 17 73337449 missense probably benign 0.00
R4194:Capn13 UTSW 17 73339484 missense possibly damaging 0.48
R4326:Capn13 UTSW 17 73331108 missense probably benign
R4788:Capn13 UTSW 17 73337432 nonsense probably null
R4852:Capn13 UTSW 17 73351506 frame shift probably null
R4853:Capn13 UTSW 17 73351506 frame shift probably null
R4855:Capn13 UTSW 17 73351506 frame shift probably null
R5063:Capn13 UTSW 17 73322079 nonsense probably null
R5112:Capn13 UTSW 17 73351506 frame shift probably null
R5438:Capn13 UTSW 17 73326484 missense probably benign
R5955:Capn13 UTSW 17 73331002 missense possibly damaging 0.92
R6408:Capn13 UTSW 17 73365959 nonsense probably null
R6512:Capn13 UTSW 17 73382990 missense probably benign 0.44
R7425:Capn13 UTSW 17 73318058 missense probably benign 0.13
R7605:Capn13 UTSW 17 73345137 critical splice donor site probably null
R7776:Capn13 UTSW 17 73322054 missense probably benign 0.07
R7791:Capn13 UTSW 17 73382888 missense possibly damaging 0.88
R8087:Capn13 UTSW 17 73316284 missense probably damaging 1.00
R8090:Capn13 UTSW 17 73382854 missense probably benign 0.07
R8122:Capn13 UTSW 17 73367210 missense probably damaging 1.00
R8169:Capn13 UTSW 17 73326472 splice site probably null
Z1176:Capn13 UTSW 17 73341110 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTCCCGAAGATACACTTTCTG -3'
(R):5'- ACTGGCTTTAAGAATTGGTTCCAC -3'

Sequencing Primer
(F):5'- GAAGATACACTTTCTGAAGCCTCAG -3'
(R):5'- ATCCCTGAAATGTGATGGCC -3'
Posted On2019-11-12