Incidental Mutation 'R7678:Eno3'
ID628400
Institutional Source Beutler Lab
Gene Symbol Eno3
Ensembl Gene ENSMUSG00000060600
Gene Nameenolase 3, beta muscle
SynonymsEno-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.813) question?
Stock #R7678 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location70657202-70662513 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to A at 70659167 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018431] [ENSMUST00000018437] [ENSMUST00000072841] [ENSMUST00000108548] [ENSMUST00000108549] [ENSMUST00000126241] [ENSMUST00000134087] [ENSMUST00000157027] [ENSMUST00000170716] [ENSMUST00000178254]
Predicted Effect probably benign
Transcript: ENSMUST00000018431
SMART Domains Protein: ENSMUSP00000018431
Gene: ENSMUSG00000018287

DomainStartEndE-ValueType
R3H 31 109 3.85e-21 SMART
low complexity region 130 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000018437
SMART Domains Protein: ENSMUSP00000018437
Gene: ENSMUSG00000018293

DomainStartEndE-ValueType
PROF 2 140 4.46e-58 SMART
Predicted Effect probably null
Transcript: ENSMUST00000072841
SMART Domains Protein: ENSMUSP00000072620
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108548
SMART Domains Protein: ENSMUSP00000104188
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108549
SMART Domains Protein: ENSMUSP00000104189
Gene: ENSMUSG00000018293

DomainStartEndE-ValueType
Pfam:Profilin 3 109 7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126241
SMART Domains Protein: ENSMUSP00000123688
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 70 7.82e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134087
SMART Domains Protein: ENSMUSP00000121640
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 78 3.53e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000157027
SMART Domains Protein: ENSMUSP00000115726
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Pfam:Enolase_C 142 196 1e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170716
SMART Domains Protein: ENSMUSP00000128714
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178254
SMART Domains Protein: ENSMUSP00000136219
Gene: ENSMUSG00000018293

DomainStartEndE-ValueType
Pfam:Profilin 3 54 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179055
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: This gene encodes one of the three enolase isoenzymes found in vertebrates. Enolase is a dimeric enzyme that converts 2-phosphoglycerate to phosphoenolpyruvate as part of the glycolytic pathway. This isozyme is found in skeletal muscle where it is involved in muscle development and regeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C A 5: 8,087,750 probably null Het
Ank1 A G 8: 23,117,058 D1325G probably damaging Het
Asxl1 T C 2: 153,400,652 S1042P probably damaging Het
Bpifb1 C T 2: 154,202,729 H39Y possibly damaging Het
Capn13 C A 17: 73,315,305 M663I probably damaging Het
Clec2g A G 6: 128,979,437 E72G probably damaging Het
Col12a1 T A 9: 79,651,486 Y1899F probably damaging Het
Ctbp2 A G 7: 133,014,624 V194A probably benign Het
Cttnbp2 G T 6: 18,382,810 L1320I probably damaging Het
E2f2 T A 4: 136,192,826 L374* probably null Het
Echdc3 C T 2: 6,212,876 G29S probably benign Het
Ecm1 A G 3: 95,736,182 S269P probably damaging Het
Elmo2 G A 2: 165,291,744 P775S unknown Het
Faf1 G A 4: 109,829,864 R267K probably benign Het
Fam162a G A 16: 36,049,937 probably benign Het
Fam178b T A 1: 36,564,451 D473V probably damaging Het
Fat2 G A 11: 55,282,330 T2519I probably damaging Het
Foxc2 A G 8: 121,118,095 Y494C probably damaging Het
Gcnt2 C A 13: 40,953,719 Q355K probably benign Het
Glg1 G T 8: 111,178,865 H595N probably benign Het
Gm9913 A T 2: 125,506,560 H97L unknown Het
Hbegf T A 18: 36,507,548 N152I possibly damaging Het
Hipk1 G A 3: 103,760,550 T567I probably damaging Het
Idh3a C T 9: 54,595,169 P78S probably damaging Het
Igsf10 A T 3: 59,319,340 M2304K possibly damaging Het
Inf2 A G 12: 112,606,994 T723A unknown Het
Itpr2 A T 6: 146,187,550 F2220Y probably benign Het
Kpnb1 C T 11: 97,169,173 R557Q probably damaging Het
Lefty1 A G 1: 180,936,760 D155G probably damaging Het
Lrp1 A G 10: 127,574,053 C1554R probably damaging Het
Lrrc10 A G 10: 117,045,757 D112G probably benign Het
Med12l A G 3: 59,076,720 E439G probably damaging Het
Ms4a7 A T 19: 11,324,504 F185Y probably benign Het
Mtmr6 T A 14: 60,289,652 M234K probably damaging Het
Myh7b C A 2: 155,617,778 probably null Het
Myo1d T C 11: 80,676,893 M254V possibly damaging Het
Nbas T C 12: 13,415,661 V1368A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Neb A G 2: 52,206,702 V4999A probably damaging Het
Npbwr1 G T 1: 5,916,708 Q196K probably benign Het
Nsd3 A T 8: 25,659,817 E339D possibly damaging Het
Olfr738 T C 14: 50,414,014 F157L probably damaging Het
Olfr776 A G 10: 129,261,068 S36G probably damaging Het
Olfr867 T C 9: 20,054,605 N168S probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna1 C T 6: 89,331,900 V1199M probably damaging Het
Ppfibp2 T A 7: 107,716,666 M285K probably damaging Het
Ppip5k1 A G 2: 121,337,661 Y704H probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sbspon T C 1: 15,859,058 M170V probably benign Het
Scfd2 A C 5: 74,458,636 F440V probably benign Het
Slc22a19 T A 19: 7,710,937 D86V possibly damaging Het
Smg5 A G 3: 88,353,895 N685S possibly damaging Het
Spata46 A G 1: 170,311,764 R111G possibly damaging Het
Sry A T Y: 2,663,248 D137E possibly damaging Het
Tbkbp1 T C 11: 97,149,483 D35G probably damaging Het
Tcf20 A T 15: 82,851,565 V1895D possibly damaging Het
Tfap4 G T 16: 4,551,766 Q112K possibly damaging Het
Tmem2 C A 19: 21,798,116 T241K probably damaging Het
Trmt10c T A 16: 56,034,939 D111V probably benign Het
Unc80 T C 1: 66,649,722 I2415T probably benign Het
Vmn2r107 A T 17: 20,356,639 M300L probably benign Het
Vmn2r5 A T 3: 64,509,522 F72I probably benign Het
Vmn2r53 T A 7: 12,598,498 H408L probably benign Het
Zan C T 5: 137,463,540 V1126M unknown Het
Zfp493 A T 13: 67,779,695 probably benign Het
Zfp618 C A 4: 63,086,621 A86E probably benign Het
Other mutations in Eno3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02479:Eno3 APN 11 70660888 splice site probably benign
IGL02591:Eno3 APN 11 70662027 missense probably damaging 1.00
IGL02868:Eno3 APN 11 70662000 missense probably damaging 1.00
R0242:Eno3 UTSW 11 70657935 missense probably null 1.00
R0242:Eno3 UTSW 11 70657935 missense probably null 1.00
R0970:Eno3 UTSW 11 70660802 missense probably damaging 1.00
R1518:Eno3 UTSW 11 70661077 nonsense probably null
R1587:Eno3 UTSW 11 70661470 missense probably damaging 0.99
R1663:Eno3 UTSW 11 70662274 critical splice donor site probably null
R1675:Eno3 UTSW 11 70658666 critical splice donor site probably null
R1758:Eno3 UTSW 11 70661425 missense possibly damaging 0.77
R3983:Eno3 UTSW 11 70661411 missense probably damaging 0.98
R4990:Eno3 UTSW 11 70658647 missense probably damaging 0.99
R4992:Eno3 UTSW 11 70658647 missense probably damaging 0.99
R5170:Eno3 UTSW 11 70662214 missense probably benign 0.00
R6116:Eno3 UTSW 11 70661575 missense possibly damaging 0.70
R6917:Eno3 UTSW 11 70661436 missense probably benign
R7060:Eno3 UTSW 11 70661419 missense possibly damaging 0.95
R7128:Eno3 UTSW 11 70658604 missense possibly damaging 0.76
R7696:Eno3 UTSW 11 70661983 missense probably benign 0.00
R7954:Eno3 UTSW 11 70661180 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACCTGTAAGAGTCCTCATGC -3'
(R):5'- TGAGCTCTGGACAGGAATGG -3'

Sequencing Primer
(F):5'- GTAAGAGTCCTCATGCTTTCTCC -3'
(R):5'- CCTCAGAGGCTTAGCTTTAGATG -3'
Posted On2020-03-19