Incidental Mutation 'R7730:Srsf6'
ID595755
Institutional Source Beutler Lab
Gene Symbol Srsf6
Ensembl Gene ENSMUSG00000016921
Gene Nameserine/arginine-rich splicing factor 6
SynonymsSfrs6, 1210001E11Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock #R7730 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location162931528-162937121 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 162931723 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 18 (I18T)
Ref Sequence ENSEMBL: ENSMUSP00000141349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017065] [ENSMUST00000126163] [ENSMUST00000130411]
Predicted Effect probably damaging
Transcript: ENSMUST00000017065
AA Change: I18T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142183
Gene: ENSMUSG00000016921
AA Change: I18T

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126163
AA Change: I18T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141349
Gene: ENSMUSG00000016921
AA Change: I18T

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130411
AA Change: I18T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119065
Gene: ENSMUSG00000016921
AA Change: I18T

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
low complexity region 74 100 N/A INTRINSIC
RRM 111 179 6.97e-14 SMART
low complexity region 184 280 N/A INTRINSIC
low complexity region 291 303 N/A INTRINSIC
low complexity region 313 338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193611
Meta Mutation Damage Score 0.8156 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T A 11: 48,947,876 H628L probably benign Het
Adam6a T A 12: 113,544,040 V11E possibly damaging Het
Amotl1 T G 9: 14,555,763 K660T possibly damaging Het
Ap4m1 T C 5: 138,172,815 I59T probably damaging Het
Brd3 T C 2: 27,456,955 Y389C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Card11 C A 5: 140,885,996 R650L probably damaging Het
Cercam G A 2: 29,872,562 probably null Het
Cnst T C 1: 179,625,085 C673R probably damaging Het
Dld G T 12: 31,340,865 T194K probably benign Het
Dnah12 T A 14: 26,785,933 W1714R probably damaging Het
Dsg1a T G 18: 20,331,711 V421G possibly damaging Het
Fer1l4 G T 2: 156,048,934 P188Q probably benign Het
Gpr158 T C 2: 21,826,347 S753P probably damaging Het
Hdc A T 2: 126,594,082 M623K possibly damaging Het
Herc1 CAACCCTGGTAAC CAAC 9: 66,493,190 probably benign Het
Igf2r A T 17: 12,735,991 F203I probably damaging Het
Jag2 A T 12: 112,922,041 I145N probably damaging Het
Kcnt2 T A 1: 140,518,948 F694I probably benign Het
Lpl A T 8: 68,887,448 R32* probably null Het
Mcpt4 T A 14: 56,059,971 I243L probably benign Het
Mtf1 C A 4: 124,838,619 A490E possibly damaging Het
Mycbp2 A T 14: 103,123,355 M4497K probably damaging Het
Myog T C 1: 134,291,176 probably null Het
Nav2 T C 7: 49,572,397 S1757P probably damaging Het
Olfr830 T G 9: 18,875,413 F26V probably benign Het
Osmr T A 15: 6,824,482 I583F probably damaging Het
Phf19 T A 2: 34,895,804 E551V probably damaging Het
Plxnb2 A G 15: 89,162,330 M870T probably benign Het
Psat1 A G 19: 15,918,356 F83L probably damaging Het
Reep1 T A 6: 71,780,741 V108D possibly damaging Het
Rorc A G 3: 94,393,114 T455A probably benign Het
Serinc5 T G 13: 92,685,190 I169S probably damaging Het
Serpinb6c T C 13: 33,899,309 M41V probably damaging Het
Sgsm3 A T 15: 81,008,726 N335Y probably damaging Het
Slamf7 C T 1: 171,641,021 R101H possibly damaging Het
Slc17a4 A T 13: 23,900,520 L427* probably null Het
Slc35a5 T C 16: 45,143,883 Q329R probably damaging Het
Slc45a1 C T 4: 150,630,940 C656Y probably damaging Het
Syn3 T G 10: 86,448,909 H109P probably benign Het
Synj2 T C 17: 6,016,287 V580A probably benign Het
Tbc1d9b T C 11: 50,135,915 V70A possibly damaging Het
Tc2n A G 12: 101,651,147 Y402H probably damaging Het
Tmbim4 T C 10: 120,223,862 C164R possibly damaging Het
Tnfrsf11b T A 15: 54,254,074 R262* probably null Het
Tnip1 T C 11: 54,937,979 K121E probably benign Het
Tut1 T C 19: 8,964,376 probably null Het
Uhrf2 T A 19: 30,075,101 C332S probably damaging Het
Vmn2r101 A G 17: 19,611,688 I649V possibly damaging Het
Vwa8 A G 14: 78,995,149 T644A probably benign Het
Zfhx2 T C 14: 55,066,900 H1209R possibly damaging Het
Zfp384 A G 6: 125,031,672 I306V probably benign Het
Zfp964 A G 8: 69,663,710 E320G possibly damaging Het
Zmym2 A T 14: 56,956,181 Y1151F possibly damaging Het
Other mutations in Srsf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Srsf6 APN 2 162931707 missense probably damaging 1.00
IGL01960:Srsf6 APN 2 162933754 missense probably damaging 1.00
R1292:Srsf6 UTSW 2 162934483 unclassified probably benign
R1789:Srsf6 UTSW 2 162934488 unclassified probably benign
R1936:Srsf6 UTSW 2 162934483 unclassified probably benign
R1937:Srsf6 UTSW 2 162934483 unclassified probably benign
R1939:Srsf6 UTSW 2 162934483 unclassified probably benign
R1940:Srsf6 UTSW 2 162934483 unclassified probably benign
R2225:Srsf6 UTSW 2 162931699 missense probably damaging 1.00
R2226:Srsf6 UTSW 2 162931699 missense probably damaging 1.00
R2227:Srsf6 UTSW 2 162931699 missense probably damaging 1.00
R4026:Srsf6 UTSW 2 162934291 unclassified probably benign
R4290:Srsf6 UTSW 2 162934716 unclassified probably benign
R4292:Srsf6 UTSW 2 162934716 unclassified probably benign
R4293:Srsf6 UTSW 2 162934716 unclassified probably benign
R4294:Srsf6 UTSW 2 162934716 unclassified probably benign
R4295:Srsf6 UTSW 2 162934716 unclassified probably benign
R4592:Srsf6 UTSW 2 162931723 missense probably damaging 0.99
R4613:Srsf6 UTSW 2 162933709 missense probably benign 0.45
R4657:Srsf6 UTSW 2 162933427 missense probably benign 0.01
R7378:Srsf6 UTSW 2 162934569 missense unknown
R7446:Srsf6 UTSW 2 162934716 missense unknown
R7578:Srsf6 UTSW 2 162932862 missense probably benign 0.00
R7908:Srsf6 UTSW 2 162933840 missense unknown
R7989:Srsf6 UTSW 2 162933840 missense unknown
X0020:Srsf6 UTSW 2 162933498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTACGCTGATGGCTGCAC -3'
(R):5'- TTGAGCTCGTACACGGCATC -3'

Sequencing Primer
(F):5'- ACTTATAGCGTAGGCCGGC -3'
(R):5'- GGAGTCCTCGAACTCCACG -3'
Posted On2019-11-12