Incidental Mutation 'R7771:Ide'
ID598611
Institutional Source Beutler Lab
Gene Symbol Ide
Ensembl Gene ENSMUSG00000056999
Gene Nameinsulin degrading enzyme
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7771 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location37268743-37337852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37298126 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 495 (N495D)
Gene Model predicted gene model for transcript(s):
Predicted Effect
SMART Domains Protein: ENSMUSP00000121358
Gene: ENSMUSG00000056999
AA Change: N495D

DomainStartEndE-ValueType
Pfam:Peptidase_M16 42 180 8.1e-49 PFAM
Pfam:Peptidase_M16_C 205 385 2.1e-25 PFAM
Pfam:Peptidase_M16_M 389 671 1.9e-106 PFAM
Pfam:Peptidase_M16_C 674 857 9.4e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc metallopeptidase that degrades intracellular insulin, and thereby terminates insulins activity, as well as participating in intercellular peptide signalling by degrading diverse peptides such as glucagon, amylin, bradykinin, and kallidin. The preferential affinity of this enzyme for insulin results in insulin-mediated inhibition of the degradation of other peptides such as beta-amyloid. Deficiencies in this protein's function are associated with Alzheimer's disease and type 2 diabetes mellitus but mutations in this gene have not been shown to be causitive for these diseases. This protein localizes primarily to the cytoplasm but in some cell types localizes to the extracellular space, cell membrane, peroxisome, and mitochondrion. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described but have not been experimentally verified.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a disruption of this gene display beta amyloid accumulations in the brain, hyperinsulinemia and glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,239,191 A1287T probably damaging Het
Ahnak A G 19: 9,015,047 K4565R probably damaging Het
Asb13 A G 13: 3,649,463 Y221C probably damaging Het
BB014433 C T 8: 15,042,395 V153M probably damaging Het
Brip1 T C 11: 86,062,024 E977G probably benign Het
C3 T A 17: 57,215,797 D1029V probably damaging Het
Ccdc116 T C 16: 17,139,591 E568G probably benign Het
Cdhr2 T C 13: 54,718,275 V296A probably damaging Het
Cenpe A G 3: 135,240,941 probably null Het
Cnot1 A G 8: 95,765,125 V357A probably damaging Het
Coa3 A T 11: 101,278,815 M38K possibly damaging Het
Cyp2d26 T C 15: 82,791,746 N255S probably benign Het
Cysrt1 T C 2: 25,239,225 S92G probably benign Het
D030056L22Rik A G 19: 18,713,478 E52G possibly damaging Het
Derl1 T C 15: 57,880,040 D97G probably damaging Het
Ebf3 A G 7: 137,309,363 Y141H probably damaging Het
Eci1 T A 17: 24,433,151 L49* probably null Het
Fam208a A G 14: 27,467,559 T923A probably damaging Het
Gm7534 A T 4: 134,195,443 N526K probably benign Het
Gzma C T 13: 113,098,295 C54Y probably damaging Het
Hydin A G 8: 110,565,085 N3403S probably damaging Het
Ighv1-23 T A 12: 114,764,736 Q22L probably benign Het
Itgb2l A G 16: 96,426,972 C444R probably damaging Het
Kcnj3 C A 2: 55,446,937 H272N probably damaging Het
Lrp6 C T 6: 134,462,616 C1218Y probably damaging Het
Lrrd1 T C 5: 3,866,476 M831T possibly damaging Het
Map3k11 A G 19: 5,690,608 E121G probably damaging Het
Mzt1 A T 14: 99,040,576 I52N probably damaging Het
Olfr339 T C 2: 36,422,144 S249P possibly damaging Het
Olfr617 A G 7: 103,584,090 I23V probably benign Het
Olfr857 T A 9: 19,713,471 F215I probably benign Het
Pcdhb17 A C 18: 37,486,909 Y584S possibly damaging Het
Per3 A T 4: 151,026,200 D380E probably damaging Het
Per3 A T 4: 151,041,445 L139Q probably damaging Het
Pik3cg T C 12: 32,204,014 H658R probably benign Het
Pitpnm3 G A 11: 72,061,488 Q626* probably null Het
Polr3e T C 7: 120,940,578 V542A probably benign Het
Rgs22 T A 15: 36,050,078 H866L possibly damaging Het
Rnf150 A G 8: 82,864,203 E65G probably benign Het
Sema3f C A 9: 107,692,426 R100L possibly damaging Het
Smim18 T C 8: 33,742,342 D83G possibly damaging Het
Snx13 T A 12: 35,124,528 D685E probably benign Het
Stat5a A C 11: 100,863,219 N125T probably benign Het
Stk24 T C 14: 121,337,633 E21G probably damaging Het
Tlr3 C T 8: 45,403,039 V35I probably benign Het
Tmem8 T C 17: 26,122,073 Y717H probably damaging Het
Tmprss11b A T 5: 86,661,695 probably null Het
Trpm2 T C 10: 77,932,179 I829V probably benign Het
Ttc37 A G 13: 76,135,030 H792R probably benign Het
Ttc39a T C 4: 109,431,450 Y276H probably damaging Het
Vmn2r98 T A 17: 19,067,198 probably null Het
Wdr73 G A 7: 80,893,227 A211V probably benign Het
Zc3h4 T C 7: 16,429,899 V673A unknown Het
Zfp382 A G 7: 30,133,335 H137R probably damaging Het
Zp2 T G 7: 120,143,642 D89A probably damaging Het
Zranb3 A C 1: 128,032,868 Y220D probably damaging Het
Zswim8 G A 14: 20,712,980 V316I probably damaging Het
Other mutations in Ide
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ide APN 19 37276532 missense unknown
IGL01924:Ide APN 19 37272164 missense unknown
IGL01925:Ide APN 19 37277897 missense unknown
IGL02616:Ide APN 19 37298056 missense unknown
R0738:Ide UTSW 19 37277965 nonsense probably null
R1509:Ide UTSW 19 37285204 critical splice donor site probably null
R1557:Ide UTSW 19 37280761 splice site probably null
R2935:Ide UTSW 19 37325307 missense unknown
R4260:Ide UTSW 19 37329186 missense unknown
R4261:Ide UTSW 19 37329186 missense unknown
R4575:Ide UTSW 19 37272205 missense unknown
R4913:Ide UTSW 19 37329070 missense unknown
R4933:Ide UTSW 19 37277756 missense unknown
R4951:Ide UTSW 19 37285232 missense unknown
R5102:Ide UTSW 19 37314984 missense unknown
R5474:Ide UTSW 19 37272184 missense unknown
R5502:Ide UTSW 19 37330456 missense unknown
R5546:Ide UTSW 19 37272224 missense unknown
R5601:Ide UTSW 19 37314980 missense unknown
R5696:Ide UTSW 19 37318021 missense unknown
R5884:Ide UTSW 19 37272153 critical splice donor site probably null
R5983:Ide UTSW 19 37272150 splice site probably null
R6286:Ide UTSW 19 37278010 missense unknown
R7146:Ide UTSW 19 37295944 missense
R7224:Ide UTSW 19 37290761 missense
R7234:Ide UTSW 19 37290785 missense
R7695:Ide UTSW 19 37329036 missense
R7811:Ide UTSW 19 37330511 missense
R7893:Ide UTSW 19 37284151 missense
R7976:Ide UTSW 19 37284151 missense
Z1176:Ide UTSW 19 37315491 missense
Predicted Primers PCR Primer
(F):5'- ACCTTGAAGAGTTGGGGAAC -3'
(R):5'- TTGCTTACACGGTGGGCAAAG -3'

Sequencing Primer
(F):5'- TTGGGGAACATAAGATGCCC -3'
(R):5'- TTCCCGAGCACTAGGATTGCAG -3'
Posted On2019-11-26