Incidental Mutation 'RF003:Sepsecs'
ID 602612
Institutional Source Beutler Lab
Gene Symbol Sepsecs
Ensembl Gene ENSMUSG00000029173
Gene Name Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase
Synonyms SecS, D5Ertd135e, SLA
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # RF003 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 52797429-52827050 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 52804533 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 379 (T379M)
Ref Sequence ENSEMBL: ENSMUSP00000031069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031069] [ENSMUST00000126574] [ENSMUST00000150709]
AlphaFold Q6P6M7
PDB Structure Crystal structure of mouse selenocysteine synthase [X-RAY DIFFRACTION]
Crystal structure of mouse selenocysteine synthase, sodium iodide soak [X-RAY DIFFRACTION]
Crystal structure of mouse selenocysteine synthase, sodium phosphate soak [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000031069
AA Change: T379M

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031069
Gene: ENSMUSG00000029173
AA Change: T379M

DomainStartEndE-ValueType
Pfam:SepSecS 61 459 4e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126574
SMART Domains Protein: ENSMUSP00000114413
Gene: ENSMUSG00000029173

DomainStartEndE-ValueType
Pfam:SLA_LP_auto_ag 1 116 5.8e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150709
SMART Domains Protein: ENSMUSP00000115477
Gene: ENSMUSG00000029173

DomainStartEndE-ValueType
PDB:3HL2|D 1 69 4e-39 PDB
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The amino acid selenocysteine is the only amino acid that does not have its own tRNA synthetase. Instead, this amino acid is synthesized on its cognate tRNA in a three step process. The protein encoded by this gene catalyzes the third step in the process, the conversion of O-phosphoseryl-tRNA(Sec) to selenocysteinyl-tRNA(Sec).[provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,642,479 (GRCm39) probably benign Het
A630073D07Rik A C 6: 132,604,406 (GRCm39) L13R unknown Het
Alg9 GGC GGCCGC 9: 50,686,727 (GRCm39) probably benign Het
Arb2a A T 13: 77,982,794 (GRCm39) I135L possibly damaging Het
Arc G C 15: 74,543,980 (GRCm39) T81S probably benign Het
Atad5 A T 11: 80,002,386 (GRCm39) K1059N probably damaging Het
Bdp1 C A 13: 100,196,957 (GRCm39) V1143F probably benign Het
Bdp1 C A 13: 100,196,958 (GRCm39) Q1142H probably benign Het
Ccdc33 T C 9: 57,965,574 (GRCm39) S583G probably benign Het
Cd109 TTAT TTATTTATTTATATAT 9: 78,619,813 (GRCm39) probably benign Het
Cep192 A T 18: 67,971,027 (GRCm39) R1009S probably benign Het
Clvs2 T A 10: 33,498,921 (GRCm39) H3L probably damaging Het
Cnot6 T C 11: 49,593,440 (GRCm39) M14V probably benign Het
Colec10 A G 15: 54,325,787 (GRCm39) R206G possibly damaging Het
Dennd6a T C 14: 26,350,689 (GRCm39) I598T probably damaging Het
Dmrt2 T C 19: 25,655,498 (GRCm39) S366P probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,821,427 (GRCm39) probably null Het
Efhb T C 17: 53,707,919 (GRCm39) D748G probably damaging Het
Etl4 C T 2: 20,524,729 (GRCm39) Q21* probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACACACTCCTGGTGT 17: 23,981,140 (GRCm39) probably null Het
Fmn1 ACCTCC ACCTCCCCCTCC 2: 113,356,131 (GRCm39) probably benign Het
Fsip2 T A 2: 82,821,865 (GRCm39) M5866K probably benign Het
Gab3 CTT CTTATT X: 74,043,612 (GRCm39) probably null Het
Garin5a C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA 7: 44,149,951 (GRCm39) probably null Het
Gnl2 T A 4: 124,937,518 (GRCm39) probably null Het
Grip2 C T 6: 91,760,574 (GRCm39) R341Q probably benign Het
Hmcn1 T A 1: 150,500,312 (GRCm39) H3960L probably damaging Het
Igkv6-25 T A 6: 70,192,762 (GRCm39) Y56* probably null Het
Il12a A T 3: 68,602,562 (GRCm39) T102S probably benign Het
Il1a T A 2: 129,144,852 (GRCm39) I189F possibly damaging Het
Inpp4b T A 8: 82,696,150 (GRCm39) Y361* probably null Het
Iqcf4 CTTTTCCTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCATTTTCCTTTTCCTTTT 9: 106,447,806 (GRCm39) probably benign Het
Irag2 AGCACATTG AGCACATTGTGCACATTG 6: 145,119,509 (GRCm39) probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Las1l AGTGG AGTGGTGG X: 94,984,422 (GRCm39) probably benign Het
Lrrc8d T C 5: 105,960,507 (GRCm39) Y306H probably damaging Het
Mamld1 AGC AGCCGC X: 70,162,426 (GRCm39) probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,136,777 (GRCm39) probably benign Het
Map1b G T 13: 99,567,258 (GRCm39) A1821E unknown Het
Maz A G 7: 126,624,669 (GRCm39) C284R probably damaging Het
Med23 A G 10: 24,779,683 (GRCm39) H920R probably damaging Het
Megf10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 18: 57,427,099 (GRCm39) probably benign Het
Mmp14 C T 14: 54,676,471 (GRCm39) R339* probably null Het
Mroh9 T G 1: 162,885,630 (GRCm39) K334T probably damaging Het
Nab1 A T 1: 52,518,441 (GRCm39) C320S probably damaging Het
Noto T C 6: 85,401,192 (GRCm39) S74P probably benign Het
Nudt4 T C 10: 95,385,236 (GRCm39) N152D possibly damaging Het
Nup155 T TTTTG 15: 8,148,660 (GRCm39) probably benign Het
Nusap1 AGCTGAGA AGCTGAGATACACGTTAGCAGTGAGGAGCAGGCTGAGA 2: 119,458,084 (GRCm39) probably benign Het
Or10al2 A C 17: 37,983,749 (GRCm39) K278N probably damaging Het
Or2d4 T A 7: 106,543,855 (GRCm39) M118L probably damaging Het
Or2t48 CA C 11: 58,419,983 (GRCm39) probably null Het
Or51f1e TTA TTAGTA 7: 102,747,513 (GRCm39) probably null Het
Or51f1e GTTAT GTTATTAT 7: 102,747,512 (GRCm39) Het
Or7g16 T C 9: 18,726,778 (GRCm39) T271A probably benign Het
Or9a7 T C 6: 40,521,296 (GRCm39) I206V probably benign Het
Plxnc1 T C 10: 94,630,306 (GRCm39) Y1531C probably damaging Het
Pnma8b TGA TGAAGA 7: 16,679,941 (GRCm39) probably benign Het
Rp1 A G 1: 4,414,917 (GRCm39) V2065A probably damaging Het
Sbp AAGATGCTGACAACA AAGATGCTGACAACAGAGATGCTGACAACA 17: 24,164,343 (GRCm39) probably benign Het
Sfswap GGCC GGCCCACTCTGCC 5: 129,646,828 (GRCm39) probably benign Het
Six3 GCG GCGTCG 17: 85,928,798 (GRCm39) probably benign Het
Tfeb C T 17: 48,099,003 (GRCm39) T259I possibly damaging Het
Tgoln1 A AAACTCAG 6: 72,593,335 (GRCm39) probably null Het
Tmem94 G A 11: 115,686,958 (GRCm39) V1108M probably damaging Het
Usp35 T C 7: 96,971,303 (GRCm39) K297E possibly damaging Het
Vcpkmt T A 12: 69,629,598 (GRCm39) T55S possibly damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,013,446 (GRCm39) probably benign Het
Zfp384 GGCCC GGCCCTGGCCCAAGCCC 6: 125,013,439 (GRCm39) probably benign Het
Zfp407 A T 18: 84,227,688 (GRCm39) S1974T probably benign Het
Zfp677 T C 17: 21,617,704 (GRCm39) S254P probably damaging Het
Other mutations in Sepsecs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Sepsecs APN 5 52,801,402 (GRCm39) missense probably benign 0.00
IGL02685:Sepsecs APN 5 52,804,534 (GRCm39) missense probably benign
IGL03033:Sepsecs APN 5 52,818,018 (GRCm39) missense probably damaging 1.00
R1051:Sepsecs UTSW 5 52,822,698 (GRCm39) missense probably damaging 1.00
R1240:Sepsecs UTSW 5 52,818,021 (GRCm39) missense probably damaging 1.00
R2014:Sepsecs UTSW 5 52,804,966 (GRCm39) missense probably benign
R2015:Sepsecs UTSW 5 52,804,966 (GRCm39) missense probably benign
R3855:Sepsecs UTSW 5 52,821,616 (GRCm39) missense probably damaging 1.00
R4687:Sepsecs UTSW 5 52,801,213 (GRCm39) missense probably benign 0.00
R5120:Sepsecs UTSW 5 52,818,003 (GRCm39) missense probably damaging 1.00
R5314:Sepsecs UTSW 5 52,805,015 (GRCm39) missense probably benign 0.01
R5468:Sepsecs UTSW 5 52,801,356 (GRCm39) missense probably damaging 1.00
R6924:Sepsecs UTSW 5 52,821,646 (GRCm39) missense probably benign 0.13
R7002:Sepsecs UTSW 5 52,804,550 (GRCm39) critical splice acceptor site probably null
R7507:Sepsecs UTSW 5 52,801,397 (GRCm39) missense probably damaging 0.99
R7527:Sepsecs UTSW 5 52,801,393 (GRCm39) missense possibly damaging 0.85
R7792:Sepsecs UTSW 5 52,801,391 (GRCm39) missense probably damaging 1.00
R7798:Sepsecs UTSW 5 52,804,531 (GRCm39) missense probably benign
R9232:Sepsecs UTSW 5 52,823,344 (GRCm39) missense probably benign 0.01
R9429:Sepsecs UTSW 5 52,801,294 (GRCm39) missense probably benign 0.02
R9797:Sepsecs UTSW 5 52,826,239 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGTTCAAAAGCTACAGATGTCC -3'
(R):5'- TGAGGGAATCAGATCATGTGTG -3'

Sequencing Primer
(F):5'- AGCTACAGATGTCCATCCTGG -3'
(R):5'- GTCCATGATTATGTACGTGTTTTCTC -3'
Posted On 2019-12-04