Incidental Mutation 'RF042:Pdia4'
ID604866
Institutional Source Beutler Lab
Gene Symbol Pdia4
Ensembl Gene ENSMUSG00000025823
Gene Nameprotein disulfide isomerase associated 4
SynonymsCai, U48620, Erp72, ERp72
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF042 (G1)
Quality Score217.468
Status Not validated
Chromosome6
Chromosomal Location47796141-47813430 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTCTTCCTCCT to C at 47808306 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077290]
Predicted Effect probably null
Transcript: ENSMUST00000077290
SMART Domains Protein: ENSMUSP00000076521
Gene: ENSMUSG00000025823

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 29 57 N/A INTRINSIC
Pfam:Thioredoxin 59 163 4.1e-34 PFAM
Pfam:Calsequestrin 165 388 5.2e-13 PFAM
Pfam:Thioredoxin 174 278 3e-34 PFAM
Pfam:Thioredoxin_6 308 500 5.9e-21 PFAM
Pfam:Thioredoxin 522 630 5e-33 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, three catalytically active thioredoxin (TRX) domains, two TRX-like domains and a C-terminal ER-retention sequence. This protein, when bound to cyclophilin B, enhances the rate of immunoglobulin G intermolecular disulfide bonding and antibody assembly. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in platelets exhibit decreased platelet aggregation and increased bleeding time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGGAAGGAAAAGGTGGCCAG 6: 131,552,886 probably benign Het
A030005L19Rik GCTGCTG GCTGCTGTGACTGCTG 1: 82,913,584 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,217 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Cntnap1 TTT TTTTGTT 11: 101,180,305 probably benign Het
Cul9 TTCTC TTC 17: 46,540,615 probably null Het
Dnmt1 GGGGCGGAGCACAGTTCCTACCTCGTT GGGGCGGAGCACAGTTCCTACCTCGTTTTGTGGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,119 probably null Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 TCT TCTACT X: 75,000,005 probably benign Het
Gab3 TTC TTCGTC X: 75,000,022 probably benign Het
Gabre GGCTCC GGCTCCTGCTCC X: 72,270,047 probably benign Het
Gm8369 TGTG TGTGAGTG 19: 11,511,773 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,778 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Igkv12-89 G GCAACGCCAT 6: 68,835,286 probably benign Het
Iqcf4 TCCTTTTCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTTCCTTTT 9: 106,570,605 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,042,125 probably benign Het
Las1l CTTCCT CTTCCTTTTCCT X: 95,940,620 probably benign Het
Lca5l GCCCTGGCCCTGGCCCC GCCC 16: 96,159,297 probably null Het
Lce1m CACTGCTGCTGC CACTGCTGCTGCAACTGCTGCTGC 3: 93,018,139 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAATA 11: 58,390,243 probably benign Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 A AGCC X: 71,118,853 probably benign Het
Map1a T TTGCTCCACCTCCAGCTCCAGCTCCAGCTCC 2: 121,306,287 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Nusap1 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA 2: 119,627,607 probably null Het
Opa3 GCGGGC GCGGGCGGAGCTGCGGGCGGAGCTGCGGGCGGAGCTACGGGC 7: 19,255,669 probably benign Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Sbp AAGA AAGACGCTGACAACAGAGA 17: 23,945,384 probably benign Het
Sfswap CTCGGCCCA CTCGGCCCAGTCGGCCCA 5: 129,569,743 probably benign Het
Slc39a4 TC TCATCATGATCACCATGGTCACCATGATCACTGTGGCC 15: 76,614,871 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Zfhx3 GC GCCACAGCAAC 8: 108,956,088 probably benign Het
Zfhx3 CAGCAGCA CAGCAGCAAAAGCAGCA 8: 108,956,098 probably benign Het
Other mutations in Pdia4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01882:Pdia4 APN 6 47803478 missense probably benign 0.25
IGL02207:Pdia4 APN 6 47796807 missense probably benign 0.01
IGL02456:Pdia4 APN 6 47803495 missense probably benign 0.19
R0078:Pdia4 UTSW 6 47798410 missense possibly damaging 0.51
R0501:Pdia4 UTSW 6 47801002 missense probably damaging 1.00
R0622:Pdia4 UTSW 6 47806518 missense probably damaging 1.00
R1243:Pdia4 UTSW 6 47807120 missense probably damaging 1.00
R1635:Pdia4 UTSW 6 47799199 missense possibly damaging 0.85
R1830:Pdia4 UTSW 6 47796761 nonsense probably null
R1853:Pdia4 UTSW 6 47813227 missense unknown
R1854:Pdia4 UTSW 6 47813227 missense unknown
R1951:Pdia4 UTSW 6 47803879 missense probably damaging 1.00
R1990:Pdia4 UTSW 6 47796655 missense probably benign
R2126:Pdia4 UTSW 6 47796837 missense probably damaging 1.00
R2163:Pdia4 UTSW 6 47798407 missense possibly damaging 0.77
R2351:Pdia4 UTSW 6 47796914 splice site probably null
R2415:Pdia4 UTSW 6 47806556 missense probably benign 0.27
R4375:Pdia4 UTSW 6 47798392 missense probably damaging 1.00
R4376:Pdia4 UTSW 6 47798392 missense probably damaging 1.00
R4377:Pdia4 UTSW 6 47798392 missense probably damaging 1.00
R5132:Pdia4 UTSW 6 47796735 missense probably benign 0.01
R5250:Pdia4 UTSW 6 47796685 missense possibly damaging 0.55
R5339:Pdia4 UTSW 6 47796685 missense possibly damaging 0.55
R5432:Pdia4 UTSW 6 47798466 missense possibly damaging 0.89
R5541:Pdia4 UTSW 6 47796637 missense probably damaging 1.00
R5769:Pdia4 UTSW 6 47815512 unclassified probably benign
R5873:Pdia4 UTSW 6 47808176 missense probably damaging 1.00
R6340:Pdia4 UTSW 6 47801018 missense probably benign 0.43
R7187:Pdia4 UTSW 6 47813259 missense unknown
R7231:Pdia4 UTSW 6 47800957 missense probably benign
R7791:Pdia4 UTSW 6 47807122 missense probably damaging 1.00
RF033:Pdia4 UTSW 6 47808288 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGATCCTCATTTCCCCTGGG -3'
(R):5'- GCCACGATGTGTTCCTACTTGG -3'

Sequencing Primer
(F):5'- ATTTCCCCTGGGGCCTG -3'
(R):5'- TAGCCATATAGTTTACAGAGGTGG -3'
Posted On2019-12-04