Mutagenetix > Incidental Mutation

Incidental Mutation 'R0178:Zfc3h1'

60655

Institutional Source

Beutler Lab

Gene Symbol

Zfc3h1

Ensembl Gene

ENSMUSG00000034163

Gene Name

zinc finger, C3H1-type containing

Synonyms

Ccdc131, Psrc2

MMRRC Submission

038446-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.943) question?

Stock #

R0178 (G1)

Quality Score

154

Status

Validated

Chromosome

Chromosomal Location

115220864-115268677 bp(+) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 115242630 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000044069 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036044]

AlphaFold

B2RT41

Predicted Effect

probably benign
Transcript: ENSMUST00000036044

SMART Domains

Protein: ENSMUSP00000044069
Gene: ENSMUSG00000034163

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
low complexity region	29	90	N/A	INTRINSIC
low complexity region	120	132	N/A	INTRINSIC
low complexity region	143	214	N/A	INTRINSIC
coiled coil region	361	393	N/A	INTRINSIC
low complexity region	399	432	N/A	INTRINSIC
coiled coil region	436	491	N/A	INTRINSIC
low complexity region	543	556	N/A	INTRINSIC
low complexity region	564	583	N/A	INTRINSIC
low complexity region	595	619	N/A	INTRINSIC
low complexity region	623	636	N/A	INTRINSIC
low complexity region	716	729	N/A	INTRINSIC
low complexity region	752	763	N/A	INTRINSIC
coiled coil region	826	889	N/A	INTRINSIC
coiled coil region	968	1000	N/A	INTRINSIC
low complexity region	1001	1015	N/A	INTRINSIC
Pfam:zf-C3H1	1187	1208	1.3e-11	PFAM
HAT	1384	1416	1.11e0	SMART
HAT	1418	1449	4.35e2	SMART
Blast:HAT	1495	1538	2e-9	BLAST
HAT	1653	1685	3.31e1	SMART
HAT	1762	1797	7.03e1	SMART
HAT	1922	1954	1.29e-1	SMART
low complexity region	1975	1992	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.5%
20x: 88.8%

Validation Efficiency

95% (69/73)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930596D02Rik	T	G	14: 35,533,435 (GRCm39)	N111T	probably benign	Het
Abca1	T	C	4: 53,081,953 (GRCm39)	D769G	possibly damaging	Het
Adcy6	G	T	15: 98,502,096 (GRCm39)	Q173K	probably benign	Het
Amotl1	G	A	9: 14,460,069 (GRCm39)	A890V	probably benign	Het
Arfgap2	C	T	2: 91,097,706 (GRCm39)	A141V	probably benign	Het
Asb2	G	A	12: 103,291,811 (GRCm39)	P324L	probably damaging	Het
Brd10	A	G	19: 29,732,188 (GRCm39)	S342P	probably damaging	Het
Cacna1g	G	A	11: 94,354,309 (GRCm39)	T202I	probably damaging	Het
Capn5	A	G	7: 97,782,098 (GRCm39)	L214P	probably damaging	Het
Cdh20	A	T	1: 104,902,776 (GRCm39)	D489V	possibly damaging	Het
Cers5	C	A	15: 99,644,905 (GRCm39)		probably benign	Het
Chct1	A	G	11: 85,069,264 (GRCm39)	H94R	probably benign	Het
Chrnb3	T	A	8: 27,883,392 (GRCm39)	V111D	probably damaging	Het
Clec2m	T	C	6: 129,303,786 (GRCm39)	R60G	probably benign	Het
Colec12	C	T	18: 9,858,921 (GRCm39)	P568L	unknown	Het
Cyp2r1	T	C	7: 114,149,643 (GRCm39)	E248G	probably damaging	Het
Dnaaf11	A	C	15: 66,325,950 (GRCm39)	D208E	probably benign	Het
Dnmt3b	A	G	2: 153,516,938 (GRCm39)	T536A	probably benign	Het
Eef2	G	A	10: 81,016,126 (GRCm39)	V496M	possibly damaging	Het
Fam118a	T	C	15: 84,930,081 (GRCm39)		probably benign	Het
Fer1l6	T	A	15: 58,509,763 (GRCm39)		probably null	Het
Fhad1	A	C	4: 141,682,651 (GRCm39)	F497V	probably benign	Het
Gbe1	G	A	16: 70,275,274 (GRCm39)	G358D	probably damaging	Het
Gdf10	A	G	14: 33,646,058 (GRCm39)	D69G	probably damaging	Het
Ggt6	A	G	11: 72,327,644 (GRCm39)	H150R	possibly damaging	Het
Gm45713	A	T	7: 44,783,882 (GRCm39)	L110Q	probably damaging	Het
Gm9847	T	C	12: 14,544,649 (GRCm39)		noncoding transcript	Het
Grwd1	T	C	7: 45,480,054 (GRCm39)	E51G	probably damaging	Het
Gvin3	A	T	7: 106,201,028 (GRCm39)	Y739N	probably damaging	Het
H13	A	G	2: 152,522,987 (GRCm39)	Y100C	probably damaging	Het
Kcne1	A	C	16: 92,145,697 (GRCm39)	M49R	probably damaging	Het
Kcnma1	C	T	14: 23,576,835 (GRCm39)	R236H	probably damaging	Het
Knl1	T	A	2: 118,888,886 (GRCm39)		probably benign	Het
Krt40	T	C	11: 99,432,565 (GRCm39)	I150M	probably damaging	Het
Ldb2	A	T	5: 44,630,841 (GRCm39)	V300E	probably damaging	Het
Lrp1b	A	T	2: 40,615,919 (GRCm39)	C3606S	probably damaging	Het
Lrrc42	A	G	4: 107,104,917 (GRCm39)	I16T	probably damaging	Het
Mtus1	G	T	8: 41,455,398 (GRCm39)	L87I	possibly damaging	Het
Myot	T	C	18: 44,470,053 (GRCm39)	F10S	probably damaging	Het
Nrg3	A	T	14: 38,098,413 (GRCm39)	H480Q	probably damaging	Het
Or52b2	G	A	7: 104,986,129 (GRCm39)	R265C	probably benign	Het
Or5ac23	A	T	16: 59,149,783 (GRCm39)	F30I	probably damaging	Het
Prl2c5	A	T	13: 13,366,390 (GRCm39)	D220V	probably damaging	Het
Rbm17	G	A	2: 11,592,590 (GRCm39)	S295L	probably benign	Het
Serpina6	A	G	12: 103,613,172 (GRCm39)	I376T	probably damaging	Het
Sh2d2a	A	T	3: 87,756,730 (GRCm39)	T192S	probably benign	Het
Slc27a1	T	C	8: 72,037,106 (GRCm39)	Y417H	possibly damaging	Het
Slc6a1	T	G	6: 114,281,813 (GRCm39)	I32S	possibly damaging	Het
Sntb1	T	C	15: 55,769,540 (GRCm39)	T150A	probably damaging	Het
Tanc1	T	A	2: 59,665,791 (GRCm39)	C1183*	probably null	Het
Tmprss7	C	A	16: 45,511,206 (GRCm39)	W57C	probably damaging	Het
Ubac1	A	T	2: 25,911,440 (GRCm39)	V36E	possibly damaging	Het
Zfp644	C	T	5: 106,784,771 (GRCm39)	C592Y	probably damaging	Het

Other mutations in Zfc3h1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00698:Zfc3h1	APN	10	115,255,737 (GRCm39)	missense	possibly damaging	0.92
IGL00793:Zfc3h1	APN	10	115,252,779 (GRCm39)	missense	probably benign	0.00
IGL01349:Zfc3h1	APN	10	115,259,353 (GRCm39)	missense	probably damaging	1.00
IGL01431:Zfc3h1	APN	10	115,259,128 (GRCm39)	missense	possibly damaging	0.49
IGL02273:Zfc3h1	APN	10	115,263,004 (GRCm39)	missense	probably benign
IGL02382:Zfc3h1	APN	10	115,252,781 (GRCm39)	nonsense	probably null
IGL02397:Zfc3h1	APN	10	115,243,890 (GRCm39)	missense	probably damaging	1.00
IGL02657:Zfc3h1	APN	10	115,247,859 (GRCm39)	missense	possibly damaging	0.48
IGL02826:Zfc3h1	APN	10	115,236,809 (GRCm39)	missense	probably benign	0.42
Gnatcatcher	UTSW	10	115,236,647 (GRCm39)	missense	probably benign	0.39
hutton	UTSW	10	115,251,153 (GRCm39)	missense	probably damaging	0.96
passerine	UTSW	10	115,249,916 (GRCm39)	missense	possibly damaging	0.56
R0178_Zfc3h1_655	UTSW	10	115,242,630 (GRCm39)	splice site	probably benign
vireo	UTSW	10	115,255,806 (GRCm39)	missense	probably benign	0.01
warbler	UTSW	10	115,242,388 (GRCm39)	missense	probably damaging	1.00
PIT4260001:Zfc3h1	UTSW	10	115,226,794 (GRCm39)	missense	probably damaging	0.99
PIT4354001:Zfc3h1	UTSW	10	115,262,944 (GRCm39)	nonsense	probably null
R0062:Zfc3h1	UTSW	10	115,252,658 (GRCm39)	missense	probably benign	0.00
R0062:Zfc3h1	UTSW	10	115,252,658 (GRCm39)	missense	probably benign	0.00
R0067:Zfc3h1	UTSW	10	115,259,379 (GRCm39)	missense	possibly damaging	0.88
R0067:Zfc3h1	UTSW	10	115,259,379 (GRCm39)	missense	possibly damaging	0.88
R0104:Zfc3h1	UTSW	10	115,251,192 (GRCm39)	missense	possibly damaging	0.66
R0355:Zfc3h1	UTSW	10	115,245,018 (GRCm39)	missense	possibly damaging	0.80
R0619:Zfc3h1	UTSW	10	115,256,715 (GRCm39)	missense	possibly damaging	0.92
R0731:Zfc3h1	UTSW	10	115,246,537 (GRCm39)	missense	probably benign	0.00
R0828:Zfc3h1	UTSW	10	115,237,612 (GRCm39)	missense	possibly damaging	0.68
R0866:Zfc3h1	UTSW	10	115,263,621 (GRCm39)	missense	probably benign	0.00
R1196:Zfc3h1	UTSW	10	115,247,866 (GRCm39)	missense	probably damaging	0.99
R1455:Zfc3h1	UTSW	10	115,248,013 (GRCm39)	missense	probably benign	0.11
R1515:Zfc3h1	UTSW	10	115,252,647 (GRCm39)	missense	probably benign	0.29
R1617:Zfc3h1	UTSW	10	115,226,827 (GRCm39)	missense	probably benign	0.01
R1640:Zfc3h1	UTSW	10	115,242,806 (GRCm39)	splice site	probably null
R1959:Zfc3h1	UTSW	10	115,259,158 (GRCm39)	missense	probably benign	0.34
R2039:Zfc3h1	UTSW	10	115,242,388 (GRCm39)	missense	probably damaging	1.00
R3430:Zfc3h1	UTSW	10	115,246,428 (GRCm39)	splice site	probably benign
R3691:Zfc3h1	UTSW	10	115,256,595 (GRCm39)	missense	probably benign
R3909:Zfc3h1	UTSW	10	115,255,806 (GRCm39)	missense	probably benign	0.01
R4235:Zfc3h1	UTSW	10	115,254,704 (GRCm39)	missense	probably benign	0.32
R4684:Zfc3h1	UTSW	10	115,259,290 (GRCm39)	missense	probably benign	0.03
R4816:Zfc3h1	UTSW	10	115,251,599 (GRCm39)	missense	probably benign	0.16
R4881:Zfc3h1	UTSW	10	115,236,647 (GRCm39)	missense	probably benign	0.39
R4883:Zfc3h1	UTSW	10	115,246,547 (GRCm39)	missense	probably damaging	1.00
R5038:Zfc3h1	UTSW	10	115,240,116 (GRCm39)	missense	probably benign	0.16
R5068:Zfc3h1	UTSW	10	115,254,688 (GRCm39)	nonsense	probably null
R5069:Zfc3h1	UTSW	10	115,254,688 (GRCm39)	nonsense	probably null
R5070:Zfc3h1	UTSW	10	115,254,688 (GRCm39)	nonsense	probably null
R5155:Zfc3h1	UTSW	10	115,248,026 (GRCm39)	missense	possibly damaging	0.64
R5190:Zfc3h1	UTSW	10	115,254,597 (GRCm39)	missense	probably damaging	1.00
R5499:Zfc3h1	UTSW	10	115,246,598 (GRCm39)	missense	probably damaging	1.00
R5932:Zfc3h1	UTSW	10	115,236,815 (GRCm39)	missense	probably benign	0.44
R5935:Zfc3h1	UTSW	10	115,267,262 (GRCm39)	intron	probably benign
R6165:Zfc3h1	UTSW	10	115,256,574 (GRCm39)	missense	probably benign	0.30
R6182:Zfc3h1	UTSW	10	115,226,764 (GRCm39)	missense	probably benign	0.00
R6262:Zfc3h1	UTSW	10	115,249,881 (GRCm39)	missense	probably damaging	1.00
R6382:Zfc3h1	UTSW	10	115,243,813 (GRCm39)	missense	probably benign	0.06
R6392:Zfc3h1	UTSW	10	115,237,653 (GRCm39)	missense	probably damaging	1.00
R6539:Zfc3h1	UTSW	10	115,247,907 (GRCm39)	missense	probably benign	0.26
R6723:Zfc3h1	UTSW	10	115,256,638 (GRCm39)	missense	probably benign	0.34
R7339:Zfc3h1	UTSW	10	115,239,205 (GRCm39)	missense	probably damaging	1.00
R7381:Zfc3h1	UTSW	10	115,260,535 (GRCm39)	missense	probably benign
R7404:Zfc3h1	UTSW	10	115,251,153 (GRCm39)	missense	probably damaging	0.96
R7667:Zfc3h1	UTSW	10	115,246,606 (GRCm39)	nonsense	probably null
R7748:Zfc3h1	UTSW	10	115,236,720 (GRCm39)	missense	probably benign	0.27
R7910:Zfc3h1	UTSW	10	115,256,588 (GRCm39)	nonsense	probably null
R7914:Zfc3h1	UTSW	10	115,239,062 (GRCm39)	splice site	probably null
R8023:Zfc3h1	UTSW	10	115,256,553 (GRCm39)	missense	probably damaging	1.00
R8169:Zfc3h1	UTSW	10	115,254,616 (GRCm39)	missense	probably damaging	0.98
R8358:Zfc3h1	UTSW	10	115,240,198 (GRCm39)	missense	probably benign	0.13
R8746:Zfc3h1	UTSW	10	115,243,885 (GRCm39)	missense	probably damaging	1.00
R8803:Zfc3h1	UTSW	10	115,247,800 (GRCm39)	missense	probably benign
R8905:Zfc3h1	UTSW	10	115,259,383 (GRCm39)	missense	probably benign	0.05
R9045:Zfc3h1	UTSW	10	115,263,319 (GRCm39)	missense	possibly damaging	0.49
R9164:Zfc3h1	UTSW	10	115,259,374 (GRCm39)	missense	probably benign	0.17
R9211:Zfc3h1	UTSW	10	115,248,328 (GRCm39)	missense	possibly damaging	0.83
R9216:Zfc3h1	UTSW	10	115,221,528 (GRCm39)	missense	unknown
R9305:Zfc3h1	UTSW	10	115,255,771 (GRCm39)	missense	probably benign	0.19
R9372:Zfc3h1	UTSW	10	115,221,223 (GRCm39)	missense	unknown
R9394:Zfc3h1	UTSW	10	115,254,600 (GRCm39)	missense	probably damaging	1.00
R9414:Zfc3h1	UTSW	10	115,249,916 (GRCm39)	missense	possibly damaging	0.56
R9538:Zfc3h1	UTSW	10	115,221,197 (GRCm39)	missense	unknown
R9623:Zfc3h1	UTSW	10	115,259,362 (GRCm39)	missense	possibly damaging	0.94
R9633:Zfc3h1	UTSW	10	115,247,852 (GRCm39)	missense	probably damaging	1.00
R9747:Zfc3h1	UTSW	10	115,244,821 (GRCm39)	missense	possibly damaging	0.58
Z1176:Zfc3h1	UTSW	10	115,243,907 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCTGTGCCATCTTTGAACCAACC -3'
(R):5'- CGAGATCACAGTTCGTGGAAGACG -3'

Sequencing Primer
(F):5'- TGCTCCTTCGAGAAGAACTG -3'
(R):5'- GAAGACGAGGTCCTCTGTG -3'

Posted On

2013-07-24