Incidental Mutation 'R8175:Megf6'
ID634278
Institutional Source Beutler Lab
Gene Symbol Megf6
Ensembl Gene ENSMUSG00000057751
Gene Namemultiple EGF-like-domains 6
Synonyms2600001P17Rik, Egfl3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8175 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location154170730-154275713 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 154268619 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 1307 (C1307*)
Ref Sequence ENSEMBL: ENSMUSP00000030897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030897] [ENSMUST00000152159]
Predicted Effect probably null
Transcript: ENSMUST00000030897
AA Change: C1307*
SMART Domains Protein: ENSMUSP00000030897
Gene: ENSMUSG00000057751
AA Change: C1307*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
EGF_CA 122 162 1.54e-6 SMART
EGF_CA 163 203 2.08e-12 SMART
EGF 207 245 5.4e-2 SMART
EGF 249 286 2.39e-3 SMART
EGF_CA 287 327 4.96e-10 SMART
EGF 336 373 1.64e-1 SMART
EGF 377 413 1.99e1 SMART
EGF_CA 414 454 7.4e-9 SMART
EGF 521 554 4.26e0 SMART
EGF_Lam 570 609 1.19e-3 SMART
EGF_like 613 652 5.29e-1 SMART
EGF 642 685 2.2e1 SMART
EGF_Lam 656 697 1.04e-3 SMART
EGF 687 730 1.59e1 SMART
EGF_like 701 742 2.27e0 SMART
EGF_Lam 746 784 1.33e-1 SMART
EGF 783 816 2.85e-1 SMART
EGF_Lam 832 871 3.88e-3 SMART
EGF_Lam 875 915 3.25e-5 SMART
EGF 914 946 4.7e-2 SMART
EGF_like 962 1001 1.69e-1 SMART
EGF 1000 1032 7.02e-1 SMART
EGF_Lam 1048 1087 3.1e-2 SMART
EGF 1077 1118 7.53e-1 SMART
EGF_like 1091 1130 5.59e-1 SMART
EGF 1129 1161 5.04e-2 SMART
EGF_Lam 1177 1216 2.94e-3 SMART
EGF 1206 1248 1.87e1 SMART
EGF_Lam 1220 1260 3.1e-2 SMART
EGF 1259 1291 1.73e0 SMART
EGF 1302 1334 6.55e-1 SMART
EGF 1345 1377 4.39e-2 SMART
EGF_Lam 1393 1432 7.64e-2 SMART
EGF_Lam 1436 1475 2.64e-5 SMART
EGF_like 1465 1506 4.2e1 SMART
EGF_Lam 1479 1518 1.19e-3 SMART
EGF 1517 1549 1.84e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000128700
AA Change: C174*
SMART Domains Protein: ENSMUSP00000117277
Gene: ENSMUSG00000057751
AA Change: C174*

DomainStartEndE-ValueType
EGF_Lam 3 42 3.1e-2 SMART
EGF 32 73 7.53e-1 SMART
EGF_like 46 85 8.92e-1 SMART
EGF 84 116 7.13e-2 SMART
EGF 127 159 1.73e0 SMART
EGF 170 202 6.55e-1 SMART
EGF 213 245 4.39e-2 SMART
EGF_Lam 261 300 7.64e-2 SMART
EGF 299 331 1.51e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000152159
AA Change: C1026*
SMART Domains Protein: ENSMUSP00000121641
Gene: ENSMUSG00000057751
AA Change: C1026*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF_CA 55 95 2.08e-12 SMART
EGF 99 137 5.4e-2 SMART
EGF 141 178 2.39e-3 SMART
EGF_CA 179 219 4.96e-10 SMART
EGF 228 265 1.64e-1 SMART
EGF 269 305 1.99e1 SMART
EGF_CA 306 346 7.4e-9 SMART
EGF 413 446 4.26e0 SMART
EGF_Lam 462 501 1.19e-3 SMART
EGF_like 505 544 5.29e-1 SMART
EGF 534 577 2.2e1 SMART
EGF_Lam 548 589 1.04e-3 SMART
EGF 579 622 1.59e1 SMART
EGF_like 593 634 2.27e0 SMART
EGF_Lam 638 676 1.33e-1 SMART
EGF 675 708 2.85e-1 SMART
EGF_Lam 724 763 3.88e-3 SMART
EGF_Lam 767 807 3.25e-5 SMART
EGF 806 838 4.7e-2 SMART
EGF_Lam 854 893 2.56e-3 SMART
EGF 892 924 2.02e-1 SMART
EGF 935 967 7.13e-2 SMART
EGF 978 1010 1.73e0 SMART
EGF 1021 1053 6.55e-1 SMART
EGF 1064 1096 4.39e-2 SMART
EGF 1107 1139 4.97e-1 SMART
EGF 1159 1191 1.84e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,164,448 C2548* probably null Het
Adamts15 C T 9: 30,904,656 V635M probably damaging Het
AI314180 C T 4: 58,872,756 V182M probably damaging Het
Aim2 A T 1: 173,455,354 M1L possibly damaging Het
Ank3 T C 10: 69,893,509 V700A unknown Het
Arhgap10 T C 8: 77,310,842 T586A probably benign Het
Arhgef4 G A 1: 34,810,374 V349I probably benign Het
Atp1a1 A G 3: 101,584,854 F569L possibly damaging Het
Btbd10 T A 7: 113,322,792 probably null Het
Capza2 G A 6: 17,665,382 D270N probably benign Het
Cobll1 T C 2: 65,099,231 N584D probably benign Het
Coro1c T A 5: 113,850,815 I156F probably benign Het
Cpsf3 T C 12: 21,300,177 I299T probably benign Het
Cse1l T A 2: 166,943,208 probably null Het
D5Ertd579e T C 5: 36,615,470 E527G probably damaging Het
Dcbld2 T C 16: 58,433,347 L149S possibly damaging Het
Egflam C A 15: 7,212,152 W925L probably damaging Het
Ehmt2 A G 17: 34,911,420 N1071D probably damaging Het
Eif3g A T 9: 20,897,730 S93T probably damaging Het
Eng C A 2: 32,678,922 T487K possibly damaging Het
Epb41l3 T C 17: 69,210,366 Y130H probably damaging Het
F5 A T 1: 164,192,265 R770* probably null Het
Fam227a A G 15: 79,640,660 F201S probably damaging Het
Fam50b G A 13: 34,746,864 E108K probably benign Het
Fam65c T C 2: 167,983,759 S760G probably benign Het
Fn1 A G 1: 71,599,665 I1971T probably damaging Het
Fsip2 T A 2: 82,984,744 F3607Y probably benign Het
Fsip2 A T 2: 82,987,677 I4585L probably benign Het
Gas1 T C 13: 60,176,118 N275S Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Hus1b A G 13: 30,947,232 V148A probably benign Het
Ighmbp2 A G 19: 3,266,365 L575P possibly damaging Het
Igsf21 A T 4: 140,028,231 F371Y probably damaging Het
Jade1 G T 3: 41,613,288 R597L probably benign Het
Krt4 A G 15: 101,920,549 probably null Het
Lap3 T C 5: 45,509,491 S412P probably benign Het
Lifr A G 15: 7,187,015 T824A probably damaging Het
Ndufb10 A T 17: 24,724,192 V48E possibly damaging Het
Nelfa T C 5: 33,922,013 K72R possibly damaging Het
Obscn C T 11: 58,995,960 V7767I unknown Het
Pptc7 T A 5: 122,319,819 C284S probably benign Het
Pxdc1 A G 13: 34,628,815 S218P probably damaging Het
Rabep1 T A 11: 70,884,929 W110R probably damaging Het
Ren1 T C 1: 133,354,269 Y79H possibly damaging Het
Setd1a A G 7: 127,796,243 E1327G unknown Het
Setd5 T C 6: 113,114,913 W232R probably damaging Het
Slf1 A T 13: 77,112,671 H171Q probably damaging Het
Smoc1 A G 12: 81,167,666 D285G probably damaging Het
Ssfa2 A G 2: 79,658,152 R860G probably damaging Het
Taf10 T C 7: 105,743,927 Y97C probably damaging Het
Tgfbr2 G A 9: 116,109,955 S293L possibly damaging Het
Tmem181a A G 17: 6,295,800 I190V probably benign Het
Traf6 C T 2: 101,691,480 T220I possibly damaging Het
Tssc1 A G 12: 28,863,107 E269G Het
Ube4b T C 4: 149,351,516 N716D probably benign Het
Unc5d T A 8: 28,844,827 K157N probably damaging Het
Usp19 G A 9: 108,500,178 R1255H probably damaging Het
Vmn2r12 T A 5: 109,090,483 I464F probably damaging Het
Zbtb20 A T 16: 43,577,080 probably benign Het
Zfp790 T G 7: 29,829,780 L630R possibly damaging Het
Other mutations in Megf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Megf6 APN 4 154253807 missense probably damaging 1.00
IGL01410:Megf6 APN 4 154252563 critical splice donor site probably null
IGL01512:Megf6 APN 4 154262583 missense possibly damaging 0.64
IGL01824:Megf6 APN 4 154252234 missense probably damaging 1.00
IGL02172:Megf6 APN 4 154270692 missense probably damaging 1.00
IGL02727:Megf6 APN 4 154253149 splice site probably null
IGL02966:Megf6 APN 4 154253777 missense probably damaging 1.00
Didactic UTSW 4 154254587 missense probably damaging 1.00
R0118:Megf6 UTSW 4 154254641 missense probably damaging 0.99
R0220:Megf6 UTSW 4 154258215 missense probably damaging 1.00
R0347:Megf6 UTSW 4 154254635 missense possibly damaging 0.90
R0383:Megf6 UTSW 4 154265326 missense probably benign 0.01
R0417:Megf6 UTSW 4 154267967 missense probably benign 0.06
R0526:Megf6 UTSW 4 154258941 missense probably benign
R0528:Megf6 UTSW 4 154259173 missense probably benign 0.04
R0928:Megf6 UTSW 4 154177047 missense probably damaging 1.00
R1311:Megf6 UTSW 4 154263782 splice site probably null
R1458:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1470:Megf6 UTSW 4 154252419 splice site probably benign
R1476:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1479:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1624:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1626:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1638:Megf6 UTSW 4 154262510 splice site probably benign
R1777:Megf6 UTSW 4 154270690 nonsense probably null
R1831:Megf6 UTSW 4 154270677 missense probably benign 0.00
R1944:Megf6 UTSW 4 154256066 missense possibly damaging 0.75
R1984:Megf6 UTSW 4 154267667 missense probably damaging 1.00
R2109:Megf6 UTSW 4 154177121 missense probably benign 0.39
R2448:Megf6 UTSW 4 154266645 splice site probably null
R2880:Megf6 UTSW 4 154252549 missense probably damaging 1.00
R4032:Megf6 UTSW 4 154177093 nonsense probably null
R4058:Megf6 UTSW 4 154242532 splice site probably benign
R4672:Megf6 UTSW 4 154249452 missense probably damaging 0.99
R4688:Megf6 UTSW 4 154253814 missense probably damaging 0.99
R4752:Megf6 UTSW 4 154252438 missense probably damaging 1.00
R4863:Megf6 UTSW 4 154254281 critical splice donor site probably null
R4909:Megf6 UTSW 4 154265391 missense probably damaging 1.00
R4942:Megf6 UTSW 4 154253820 missense probably damaging 1.00
R4981:Megf6 UTSW 4 154267450 missense possibly damaging 0.95
R4990:Megf6 UTSW 4 154267226 missense possibly damaging 0.94
R5001:Megf6 UTSW 4 154268060 missense probably damaging 1.00
R5189:Megf6 UTSW 4 154252523 missense probably benign 0.31
R5210:Megf6 UTSW 4 154269816 intron probably benign
R5220:Megf6 UTSW 4 154253838 critical splice donor site probably null
R5250:Megf6 UTSW 4 154256010 missense possibly damaging 0.65
R5697:Megf6 UTSW 4 154258229 missense probably null 0.15
R5808:Megf6 UTSW 4 154267662 missense probably benign
R5916:Megf6 UTSW 4 154249425 critical splice acceptor site probably null
R6054:Megf6 UTSW 4 154263179 missense probably benign 0.06
R6075:Megf6 UTSW 4 154262599 nonsense probably null
R6515:Megf6 UTSW 4 154258919 missense possibly damaging 0.84
R6599:Megf6 UTSW 4 154258087 splice site probably null
R6811:Megf6 UTSW 4 154252161 missense probably damaging 1.00
R6925:Megf6 UTSW 4 154254587 missense probably damaging 1.00
R7023:Megf6 UTSW 4 154254145 missense possibly damaging 0.95
R7117:Megf6 UTSW 4 154258922 missense possibly damaging 0.78
R7163:Megf6 UTSW 4 154267441 missense probably damaging 0.98
R7345:Megf6 UTSW 4 154267315 missense probably benign
R7580:Megf6 UTSW 4 154270744 nonsense probably null
R7649:Megf6 UTSW 4 154265085 missense probably damaging 0.96
R7702:Megf6 UTSW 4 154270470 missense probably benign 0.00
R8010:Megf6 UTSW 4 154270507 missense probably benign 0.13
R8231:Megf6 UTSW 4 154252518 missense probably damaging 1.00
R8436:Megf6 UTSW 4 154265192 missense probably damaging 1.00
R8460:Megf6 UTSW 4 154266177 nonsense probably null
R8738:Megf6 UTSW 4 154267979 missense probably benign
R8854:Megf6 UTSW 4 154268012 missense probably damaging 1.00
R8896:Megf6 UTSW 4 154242403 missense probably damaging 0.99
Z1177:Megf6 UTSW 4 154237826 missense probably benign 0.12
Z1177:Megf6 UTSW 4 154250849 missense probably damaging 1.00
Z1177:Megf6 UTSW 4 154267681 missense possibly damaging 0.48
Z1177:Megf6 UTSW 4 154267682 missense probably damaging 0.99
Z1177:Megf6 UTSW 4 154267747 nonsense probably null
Z1177:Megf6 UTSW 4 154269741 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGTCCCTGTAGAGATGGC -3'
(R):5'- CCCTCCCAAGATGAGTTCAC -3'

Sequencing Primer
(F):5'- CCAGCAGAGCCTATTCATGAGG -3'
(R):5'- CTCCCAAGATGAGTTCACTTTAGCAG -3'
Posted On2020-07-13