Incidental Mutation 'R0526:Megf6'
ID48907
Institutional Source Beutler Lab
Gene Symbol Megf6
Ensembl Gene ENSMUSG00000057751
Gene Namemultiple EGF-like-domains 6
Synonyms2600001P17Rik, Egfl3
MMRRC Submission 038719-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0526 (G1)
Quality Score210
Status Not validated
Chromosome4
Chromosomal Location154170730-154275713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154258941 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 561 (K561R)
Ref Sequence ENSEMBL: ENSMUSP00000121641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030897] [ENSMUST00000152159]
Predicted Effect probably benign
Transcript: ENSMUST00000030897
AA Change: K669R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030897
Gene: ENSMUSG00000057751
AA Change: K669R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
EGF_CA 122 162 1.54e-6 SMART
EGF_CA 163 203 2.08e-12 SMART
EGF 207 245 5.4e-2 SMART
EGF 249 286 2.39e-3 SMART
EGF_CA 287 327 4.96e-10 SMART
EGF 336 373 1.64e-1 SMART
EGF 377 413 1.99e1 SMART
EGF_CA 414 454 7.4e-9 SMART
EGF 521 554 4.26e0 SMART
EGF_Lam 570 609 1.19e-3 SMART
EGF_like 613 652 5.29e-1 SMART
EGF 642 685 2.2e1 SMART
EGF_Lam 656 697 1.04e-3 SMART
EGF 687 730 1.59e1 SMART
EGF_like 701 742 2.27e0 SMART
EGF_Lam 746 784 1.33e-1 SMART
EGF 783 816 2.85e-1 SMART
EGF_Lam 832 871 3.88e-3 SMART
EGF_Lam 875 915 3.25e-5 SMART
EGF 914 946 4.7e-2 SMART
EGF_like 962 1001 1.69e-1 SMART
EGF 1000 1032 7.02e-1 SMART
EGF_Lam 1048 1087 3.1e-2 SMART
EGF 1077 1118 7.53e-1 SMART
EGF_like 1091 1130 5.59e-1 SMART
EGF 1129 1161 5.04e-2 SMART
EGF_Lam 1177 1216 2.94e-3 SMART
EGF 1206 1248 1.87e1 SMART
EGF_Lam 1220 1260 3.1e-2 SMART
EGF 1259 1291 1.73e0 SMART
EGF 1302 1334 6.55e-1 SMART
EGF 1345 1377 4.39e-2 SMART
EGF_Lam 1393 1432 7.64e-2 SMART
EGF_Lam 1436 1475 2.64e-5 SMART
EGF_like 1465 1506 4.2e1 SMART
EGF_Lam 1479 1518 1.19e-3 SMART
EGF 1517 1549 1.84e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152159
AA Change: K561R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121641
Gene: ENSMUSG00000057751
AA Change: K561R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF_CA 55 95 2.08e-12 SMART
EGF 99 137 5.4e-2 SMART
EGF 141 178 2.39e-3 SMART
EGF_CA 179 219 4.96e-10 SMART
EGF 228 265 1.64e-1 SMART
EGF 269 305 1.99e1 SMART
EGF_CA 306 346 7.4e-9 SMART
EGF 413 446 4.26e0 SMART
EGF_Lam 462 501 1.19e-3 SMART
EGF_like 505 544 5.29e-1 SMART
EGF 534 577 2.2e1 SMART
EGF_Lam 548 589 1.04e-3 SMART
EGF 579 622 1.59e1 SMART
EGF_like 593 634 2.27e0 SMART
EGF_Lam 638 676 1.33e-1 SMART
EGF 675 708 2.85e-1 SMART
EGF_Lam 724 763 3.88e-3 SMART
EGF_Lam 767 807 3.25e-5 SMART
EGF 806 838 4.7e-2 SMART
EGF_Lam 854 893 2.56e-3 SMART
EGF 892 924 2.02e-1 SMART
EGF 935 967 7.13e-2 SMART
EGF 978 1010 1.73e0 SMART
EGF 1021 1053 6.55e-1 SMART
EGF 1064 1096 4.39e-2 SMART
EGF 1107 1139 4.97e-1 SMART
EGF 1159 1191 1.84e1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,455,224 N230I possibly damaging Het
4933427D14Rik G T 11: 72,169,783 Q687K probably damaging Het
Actrt2 A G 4: 154,667,412 L89P probably damaging Het
Adamts1 A C 16: 85,802,372 S113R probably benign Het
Agxt2 G T 15: 10,373,862 C118F probably damaging Het
Akap8 G A 17: 32,317,292 T49I probably benign Het
Alk A T 17: 71,869,753 W1519R probably damaging Het
Atf7ip T A 6: 136,559,805 F12Y probably damaging Het
Atp13a5 A G 16: 29,348,740 C131R probably damaging Het
Atp8b4 A G 2: 126,427,363 L168P probably damaging Het
Blm G T 7: 80,505,893 S346* probably null Het
Ccnt2 T G 1: 127,799,445 C199G probably damaging Het
Cd151 A T 7: 141,470,591 H219L probably damaging Het
Cd200r2 A T 16: 44,915,047 R248S probably damaging Het
Cdh3 A G 8: 106,555,446 D822G possibly damaging Het
Clec4b1 T C 6: 123,069,770 probably null Het
Cluh C A 11: 74,665,986 L951I probably benign Het
Cog7 A T 7: 121,963,271 probably null Het
Col25a1 C A 3: 130,476,394 P197Q probably damaging Het
Csde1 T A 3: 103,056,426 S636R possibly damaging Het
Ect2l C A 10: 18,199,940 C66F possibly damaging Het
Elac2 T C 11: 64,999,436 M671T probably benign Het
Evi5 T C 5: 107,821,748 N143S probably benign Het
Ext2 A G 2: 93,806,085 V228A probably damaging Het
Fbxo38 A G 18: 62,505,980 Y1084H probably damaging Het
Fcgr4 T A 1: 171,029,191 L209Q probably damaging Het
Fgd3 C T 13: 49,296,524 S83N probably benign Het
Gigyf2 T A 1: 87,421,493 M664K probably benign Het
Gm38394 T C 1: 133,658,734 I288M probably damaging Het
Il27ra A T 8: 84,039,499 S219T probably benign Het
Kif15 T C 9: 122,997,797 V800A probably damaging Het
Lmo7 T A 14: 101,900,560 D666E probably damaging Het
Lrp5 T C 19: 3,628,295 D520G probably damaging Het
Lrriq3 T A 3: 155,188,297 M545K probably benign Het
Lsm5 T A 6: 56,703,325 D44V probably damaging Het
Man1c1 G T 4: 134,569,068 Y430* probably null Het
Map4 T A 9: 110,037,278 probably null Het
Myo1e T C 9: 70,322,398 Y173H probably damaging Het
Myo6 T A 9: 80,283,541 S791R possibly damaging Het
Nol11 C A 11: 107,184,771 E144* probably null Het
Ntng2 C T 2: 29,197,062 R416Q probably damaging Het
Nxpe3 T A 16: 55,866,517 I43F possibly damaging Het
Olfr1093 A T 2: 86,786,347 T206S possibly damaging Het
Olfr1284 T A 2: 111,379,492 V164E possibly damaging Het
Pkd1l2 T C 8: 117,082,260 I64V probably damaging Het
Prf1 G A 10: 61,300,254 R103H probably benign Het
Rest A G 5: 77,281,027 D431G probably damaging Het
Serpina10 A T 12: 103,616,868 L439Q probably damaging Het
Sgk3 T G 1: 9,881,579 V176G probably damaging Het
Slc19a3 A G 1: 83,022,733 S188P probably damaging Het
Sorbs1 A G 19: 40,349,948 I336T probably damaging Het
Ssfa2 A G 2: 79,657,346 D591G probably benign Het
Strip1 C T 3: 107,620,039 probably null Het
Syt4 T C 18: 31,443,746 E185G possibly damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tgfbr3l G T 8: 4,249,439 R74L possibly damaging Het
Thoc7 A G 14: 13,949,282 M194T probably benign Het
Thsd7b T C 1: 129,951,392 Y989H probably damaging Het
Tmem156 C T 5: 65,075,818 V134I probably benign Het
Tnks A T 8: 34,853,303 V738E probably benign Het
Trpm6 A T 19: 18,792,876 I342F probably damaging Het
Vmn2r69 A T 7: 85,411,503 V291D probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Wnk1 T C 6: 119,951,992 T1292A probably damaging Het
Yes1 T A 5: 32,655,240 C285S probably benign Het
Zbtb49 T C 5: 38,213,919 N206S probably benign Het
Other mutations in Megf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Megf6 APN 4 154253807 missense probably damaging 1.00
IGL01410:Megf6 APN 4 154252563 critical splice donor site probably null
IGL01512:Megf6 APN 4 154262583 missense possibly damaging 0.64
IGL01824:Megf6 APN 4 154252234 missense probably damaging 1.00
IGL02172:Megf6 APN 4 154270692 missense probably damaging 1.00
IGL02727:Megf6 APN 4 154253149 splice site probably null
IGL02966:Megf6 APN 4 154253777 missense probably damaging 1.00
Didactic UTSW 4 154254587 missense probably damaging 1.00
R0118:Megf6 UTSW 4 154254641 missense probably damaging 0.99
R0220:Megf6 UTSW 4 154258215 missense probably damaging 1.00
R0347:Megf6 UTSW 4 154254635 missense possibly damaging 0.90
R0383:Megf6 UTSW 4 154265326 missense probably benign 0.01
R0417:Megf6 UTSW 4 154267967 missense probably benign 0.06
R0528:Megf6 UTSW 4 154259173 missense probably benign 0.04
R0928:Megf6 UTSW 4 154177047 missense probably damaging 1.00
R1311:Megf6 UTSW 4 154263782 splice site probably null
R1458:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1470:Megf6 UTSW 4 154252419 splice site probably benign
R1476:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1479:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1624:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1626:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1638:Megf6 UTSW 4 154262510 splice site probably benign
R1777:Megf6 UTSW 4 154270690 nonsense probably null
R1831:Megf6 UTSW 4 154270677 missense probably benign 0.00
R1944:Megf6 UTSW 4 154256066 missense possibly damaging 0.75
R1984:Megf6 UTSW 4 154267667 missense probably damaging 1.00
R2109:Megf6 UTSW 4 154177121 missense probably benign 0.39
R2448:Megf6 UTSW 4 154266645 intron probably null
R2880:Megf6 UTSW 4 154252549 missense probably damaging 1.00
R4032:Megf6 UTSW 4 154177093 nonsense probably null
R4058:Megf6 UTSW 4 154242532 splice site probably benign
R4672:Megf6 UTSW 4 154249452 missense probably damaging 0.99
R4688:Megf6 UTSW 4 154253814 missense probably damaging 0.99
R4752:Megf6 UTSW 4 154252438 missense probably damaging 1.00
R4863:Megf6 UTSW 4 154254281 critical splice donor site probably null
R4909:Megf6 UTSW 4 154265391 missense probably damaging 1.00
R4942:Megf6 UTSW 4 154253820 missense probably damaging 1.00
R4981:Megf6 UTSW 4 154267450 missense possibly damaging 0.95
R4990:Megf6 UTSW 4 154267226 missense possibly damaging 0.94
R5001:Megf6 UTSW 4 154268060 missense probably damaging 1.00
R5189:Megf6 UTSW 4 154252523 missense probably benign 0.31
R5210:Megf6 UTSW 4 154269816 intron probably benign
R5220:Megf6 UTSW 4 154253838 critical splice donor site probably null
R5250:Megf6 UTSW 4 154256010 missense possibly damaging 0.65
R5697:Megf6 UTSW 4 154258229 missense probably null 0.15
R5808:Megf6 UTSW 4 154267662 missense probably benign
R5916:Megf6 UTSW 4 154249425 critical splice acceptor site probably null
R6054:Megf6 UTSW 4 154263179 missense probably benign 0.06
R6075:Megf6 UTSW 4 154262599 nonsense probably null
R6515:Megf6 UTSW 4 154258919 missense possibly damaging 0.84
R6599:Megf6 UTSW 4 154258087 splice site probably null
R6811:Megf6 UTSW 4 154252161 missense probably damaging 1.00
R6925:Megf6 UTSW 4 154254587 missense probably damaging 1.00
R7023:Megf6 UTSW 4 154254145 missense possibly damaging 0.95
R7117:Megf6 UTSW 4 154258922 missense possibly damaging 0.78
R7163:Megf6 UTSW 4 154267441 missense probably damaging 0.98
R7345:Megf6 UTSW 4 154267315 missense probably benign
R7580:Megf6 UTSW 4 154270744 nonsense probably null
R7649:Megf6 UTSW 4 154265085 missense probably damaging 0.96
R7702:Megf6 UTSW 4 154270470 missense probably benign 0.00
R8010:Megf6 UTSW 4 154270507 missense probably benign 0.13
Z1177:Megf6 UTSW 4 154237826 missense probably benign 0.12
Z1177:Megf6 UTSW 4 154250849 missense probably damaging 1.00
Z1177:Megf6 UTSW 4 154267681 missense possibly damaging 0.48
Z1177:Megf6 UTSW 4 154267682 missense probably damaging 0.99
Z1177:Megf6 UTSW 4 154267747 nonsense probably null
Z1177:Megf6 UTSW 4 154269741 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTACAGCGGCATATGGATCTCAC -3'
(R):5'- GGTAAAGGGGCCATTTACACCCAG -3'

Sequencing Primer
(F):5'- GGCATATGGATCTCACCCCTG -3'
(R):5'- GATTGACAGCTTCCAGTTGTACAC -3'
Posted On2013-06-12