Incidental Mutation 'R8214:Kctd21'
ID636311
Institutional Source Beutler Lab
Gene Symbol Kctd21
Ensembl Gene ENSMUSG00000044952
Gene Namepotassium channel tetramerisation domain containing 21
SynonymsEG622320
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R8214 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location97332327-97350213 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97347341 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 7 (L7P)
Ref Sequence ENSEMBL: ENSMUSP00000051316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054107]
Predicted Effect probably damaging
Transcript: ENSMUST00000054107
AA Change: L7P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051316
Gene: ENSMUSG00000044952
AA Change: L7P

DomainStartEndE-ValueType
BTB 3 104 6.39e-14 SMART
Meta Mutation Damage Score 0.9746 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,286,621 R52Q Het
Abcc3 C T 11: 94,363,518 R718H probably damaging Het
Abcc4 T C 14: 118,500,841 M1166V probably benign Het
Abhd16b C T 2: 181,494,190 T295I probably damaging Het
Amph A G 13: 19,104,298 N319S possibly damaging Het
Ankrd27 A G 7: 35,614,519 D425G probably damaging Het
Atg4b T C 1: 93,784,887 S316P probably damaging Het
Brd4 A G 17: 32,212,947 S649P probably benign Het
Bzw1 T C 1: 58,405,037 S411P probably damaging Het
Dnah6 T C 6: 73,044,728 D3537G probably damaging Het
Dnpep A T 1: 75,315,998 W126R probably damaging Het
Efcab2 T C 1: 178,437,450 V27A probably benign Het
Kidins220 C T 12: 24,994,855 T216I probably damaging Het
Lpl T A 8: 68,892,605 M87K probably damaging Het
Lrrc16a T C 13: 24,044,232 E987G probably damaging Het
Ltn1 A G 16: 87,380,803 V1646A probably benign Het
Madcam1 A G 10: 79,666,758 T359A probably benign Het
Muc5ac A G 7: 141,802,948 K1092E possibly damaging Het
Nrg2 T C 18: 36,196,676 E162G probably benign Het
Olfr1333 A T 4: 118,830,091 F117L probably benign Het
Olfr474 T A 7: 107,954,967 S109T probably benign Het
Olfr589 A C 7: 103,155,406 S114A probably damaging Het
Pcdhb5 G T 18: 37,321,583 V339L probably benign Het
Plec A G 15: 76,192,284 W145R unknown Het
Polr3f A G 2: 144,536,310 N201D probably benign Het
Skint5 T C 4: 113,804,942 probably null Het
Slc12a2 A G 18: 57,937,719 I1048V probably benign Het
Sult2a4 A G 7: 13,989,476 I39T probably benign Het
Tenm4 T C 7: 96,895,407 V2247A probably damaging Het
Tg C T 15: 66,773,398 R2385C probably damaging Het
Tomm70a G T 16: 57,121,967 A36S unknown Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Unc45b A G 11: 82,933,888 I629M possibly damaging Het
Vmn1r16 T C 6: 57,323,439 E66G noncoding transcript Het
Vmn1r189 C T 13: 22,102,131 V179I probably benign Het
Vmn2r105 T G 17: 20,228,513 E134A probably benign Het
Wdr70 G A 15: 7,887,370 A522V probably benign Het
Zcchc11 A G 4: 108,512,150 I636V probably benign Het
Zfp184 T A 13: 21,958,825 C234S probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Kctd21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Kctd21 APN 7 97347374 missense probably damaging 1.00
R0123:Kctd21 UTSW 7 97348091 missense probably benign 0.04
R0134:Kctd21 UTSW 7 97348091 missense probably benign 0.04
R0225:Kctd21 UTSW 7 97348091 missense probably benign 0.04
R0469:Kctd21 UTSW 7 97347541 missense probably damaging 1.00
R0510:Kctd21 UTSW 7 97347541 missense probably damaging 1.00
R0606:Kctd21 UTSW 7 97347601 missense probably benign 0.01
R1438:Kctd21 UTSW 7 97347497 missense probably damaging 0.98
R4625:Kctd21 UTSW 7 97347575 missense probably damaging 1.00
R4626:Kctd21 UTSW 7 97347575 missense probably damaging 1.00
R4628:Kctd21 UTSW 7 97347575 missense probably damaging 1.00
R4629:Kctd21 UTSW 7 97347575 missense probably damaging 1.00
R5348:Kctd21 UTSW 7 97347970 missense probably benign 0.33
R6075:Kctd21 UTSW 7 97347407 missense probably damaging 1.00
R6452:Kctd21 UTSW 7 97347662 missense probably benign 0.04
R6736:Kctd21 UTSW 7 97348084 missense probably damaging 0.99
R7402:Kctd21 UTSW 7 97347763 missense possibly damaging 0.84
R7782:Kctd21 UTSW 7 97348090 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGACTGTGACTATGTAGATATGGC -3'
(R):5'- ATCTCCTGGAAGTCCTCTGG -3'

Sequencing Primer
(F):5'- CGAGACAGGGTTTCTCTGTATAGCC -3'
(R):5'- TGGAAGTCCTCTGGCAGATC -3'
Posted On2020-07-13