Incidental Mutation 'R8219:Lima1'
ID636578
Institutional Source Beutler Lab
Gene Symbol Lima1
Ensembl Gene ENSMUSG00000023022
Gene NameLIM domain and actin binding 1
Synonyms3526402A12Rik, 1110021C24Rik, EPLIN, epithelial protein lost in neoplasm
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R8219 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location99778470-99875456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 99780790 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 590 (T590K)
Ref Sequence ENSEMBL: ENSMUSP00000073371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073691] [ENSMUST00000109024]
Predicted Effect probably damaging
Transcript: ENSMUST00000073691
AA Change: T590K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073371
Gene: ENSMUSG00000023022
AA Change: T590K

DomainStartEndE-ValueType
LIM 387 439 5.14e-17 SMART
low complexity region 534 546 N/A INTRINSIC
low complexity region 570 587 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 613 626 N/A INTRINSIC
low complexity region 747 753 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109024
AA Change: T430K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104652
Gene: ENSMUSG00000023022
AA Change: T430K

DomainStartEndE-ValueType
LIM 227 279 5.14e-17 SMART
low complexity region 374 386 N/A INTRINSIC
low complexity region 410 427 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
low complexity region 453 466 N/A INTRINSIC
low complexity region 587 593 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeleton-associated protein that inhibits actin filament depolymerization and cross-links filaments in bundles. It is downregulated in some cancer cell lines. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, and expression of some of the variants maybe independently regulated. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A T 11: 50,942,536 S80T unknown Het
Acnat1 T A 4: 49,447,748 I278F probably benign Het
Adgrf5 A T 17: 43,449,859 Q815L probably benign Het
Aff1 T A 5: 103,846,333 Y1022N probably damaging Het
Ahi1 A G 10: 21,074,436 K1034E probably benign Het
Ano8 A T 8: 71,480,713 L645Q unknown Het
Atg9b A G 5: 24,386,332 L756P probably damaging Het
Atp2b2 A T 6: 113,793,850 I411N probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp6 T A 13: 38,345,987 C19S unknown Het
Borcs5 A G 6: 134,644,350 H27R probably benign Het
C77080 T A 4: 129,248,153 D65V possibly damaging Het
Cachd1 C A 4: 100,990,962 D1091E probably benign Het
Ccdc186 T A 19: 56,793,345 M801L probably benign Het
Clcn3 A T 8: 60,922,966 M658K probably damaging Het
Col1a1 C T 11: 94,943,358 R500C probably damaging Het
Cul4a T A 8: 13,146,540 D731E possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
E2f7 T A 10: 110,759,843 V133E probably damaging Het
Fam161b T C 12: 84,346,874 E575G probably benign Het
Fubp1 T A 3: 152,220,466 V275D probably damaging Het
Gabrg1 T A 5: 70,774,300 R367* probably null Het
Gm6902 G A 7: 23,273,718 A128V probably benign Het
Gnptab A G 10: 88,433,792 T786A probably benign Het
Golga2 A G 2: 32,306,480 N981D probably damaging Het
Gsap A T 5: 21,251,115 I437L probably benign Het
Gulp1 A G 1: 44,754,341 probably null Het
Kcnn1 T C 8: 70,852,855 Y237C probably damaging Het
Klhl28 A T 12: 64,951,657 N354K probably benign Het
Lama3 T C 18: 12,439,360 Y541H probably benign Het
Lamc1 A G 1: 153,247,327 Y706H probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mrgprb8 G A 7: 48,388,901 V107M possibly damaging Het
Mrpl3 T A 9: 105,057,072 N139K possibly damaging Het
Nudt16 T A 9: 105,130,437 N161I probably damaging Het
Obscn G A 11: 59,122,748 S1091L probably benign Het
Olfr1458 A C 19: 13,102,920 L122R probably damaging Het
Olfr894 A C 9: 38,219,372 D183A probably damaging Het
Oog4 T C 4: 143,439,938 M99V probably benign Het
Osbpl6 A T 2: 76,555,903 D303V probably damaging Het
Pcdhb21 T C 18: 37,514,655 F279S probably damaging Het
Peg3 G A 7: 6,708,365 T1286I probably benign Het
Phax A G 18: 56,575,682 N106S probably damaging Het
Pkdrej A G 15: 85,821,292 Y148H probably damaging Het
Ptprn2 C A 12: 117,184,737 Q706K probably benign Het
Rdh11 T G 12: 79,189,106 K23Q probably benign Het
Rit2 T A 18: 30,975,494 E146V probably damaging Het
Rnf141 T C 7: 110,837,265 probably benign Het
Sars T A 3: 108,445,062 E24V probably benign Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Slc10a5 G T 3: 10,335,324 P92Q probably benign Het
Slc24a5 A T 2: 125,085,655 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Slc6a5 A G 7: 49,912,163 M148V probably benign Het
Sorl1 T C 9: 42,041,561 probably null Het
Tgm4 A T 9: 123,045,052 Y119F probably benign Het
Tgm6 A G 2: 130,151,280 K562R probably benign Het
Tlr3 T C 8: 45,397,979 E627G possibly damaging Het
Tmprss11f A G 5: 86,530,019 L297P probably damaging Het
Tpbgl T C 7: 99,625,771 H293R probably benign Het
Trank1 A C 9: 111,364,909 K667T probably damaging Het
Trpm1 A T 7: 64,201,951 Q139L probably benign Het
Ttf2 T G 3: 100,962,563 K398T possibly damaging Het
Xpa A T 4: 46,183,150 M213K probably benign Het
Zmym2 T A 14: 56,925,859 S623T probably benign Het
Other mutations in Lima1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Lima1 APN 15 99802157 missense possibly damaging 0.47
IGL01104:Lima1 APN 15 99843700 missense probably damaging 1.00
IGL02618:Lima1 APN 15 99802216 splice site probably benign
IGL03124:Lima1 APN 15 99796734 splice site probably benign
R0312:Lima1 UTSW 15 99781087 missense possibly damaging 0.69
R0599:Lima1 UTSW 15 99802159 missense probably damaging 1.00
R0601:Lima1 UTSW 15 99780472 missense probably damaging 0.98
R1423:Lima1 UTSW 15 99819745 nonsense probably null
R1704:Lima1 UTSW 15 99819736 missense probably benign 0.00
R1784:Lima1 UTSW 15 99780463 missense possibly damaging 0.93
R1819:Lima1 UTSW 15 99819936 missense probably benign 0.01
R1968:Lima1 UTSW 15 99819684 missense probably benign
R2352:Lima1 UTSW 15 99794515 missense probably benign 0.02
R2908:Lima1 UTSW 15 99802110 critical splice donor site probably null
R4582:Lima1 UTSW 15 99780992 missense possibly damaging 0.65
R4672:Lima1 UTSW 15 99843709 missense probably damaging 1.00
R4858:Lima1 UTSW 15 99819576 missense probably benign 0.23
R6140:Lima1 UTSW 15 99781058 missense probably damaging 1.00
R6614:Lima1 UTSW 15 99783580 missense probably damaging 1.00
R6898:Lima1 UTSW 15 99781267 missense possibly damaging 0.61
R7598:Lima1 UTSW 15 99819696 missense probably benign 0.01
R7601:Lima1 UTSW 15 99819696 missense probably benign 0.01
R7878:Lima1 UTSW 15 99819550 missense probably benign 0.12
R8348:Lima1 UTSW 15 99780872 missense probably benign 0.00
R8733:Lima1 UTSW 15 99780818 missense probably damaging 1.00
R8821:Lima1 UTSW 15 99806425 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGAACTACGGTCCTTGCTCC -3'
(R):5'- ACCAAGAAGCTGAGGATCGC -3'

Sequencing Primer
(F):5'- GCCAGCGTGATTTTCCCAC -3'
(R):5'- AGGATCGCCTGGCCTCC -3'
Posted On2020-07-13