Incidental Mutation 'R8231:Abcg8'
ID637165
Institutional Source Beutler Lab
Gene Symbol Abcg8
Ensembl Gene ENSMUSG00000024254
Gene NameATP binding cassette subfamily G member 8
Synonyms1300003C16Rik, Sterolin-2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8231 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location84676302-84700333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84692785 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 258 (R258C)
Ref Sequence ENSEMBL: ENSMUSP00000035246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045714] [ENSMUST00000170725] [ENSMUST00000171915]
Predicted Effect probably damaging
Transcript: ENSMUST00000045714
AA Change: R258C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035246
Gene: ENSMUSG00000024254
AA Change: R258C

DomainStartEndE-ValueType
Pfam:ABC_tran 89 242 2.1e-29 PFAM
Pfam:ABC2_membrane 397 608 1.7e-36 PFAM
transmembrane domain 640 662 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170725
AA Change: R131C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127785
Gene: ENSMUSG00000024254
AA Change: R131C

DomainStartEndE-ValueType
Pfam:ABC_tran 1 115 2.6e-18 PFAM
Pfam:ABC2_membrane 270 481 7.4e-38 PFAM
transmembrane domain 513 535 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171915
AA Change: R257C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126675
Gene: ENSMUSG00000024254
AA Change: R257C

DomainStartEndE-ValueType
Pfam:ABC_tran 88 241 7.5e-30 PFAM
Pfam:ABC2_membrane 396 607 1.7e-37 PFAM
transmembrane domain 639 661 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. The protein encoded by this gene functions to exclude non-cholesterol sterol entry at the intestinal level, promote excretion of cholesterol and sterols into bile, and to facilitate transport of sterols back into the intestinal lumen. It is expressed in a tissue-specific manner in the liver, intestine, and gallbladder. This gene is tandemly arrayed on chromosome 2, in a head-to-head orientation with family member ABCG5. Mutations in this gene may contribute to sterol accumulation and atherosclerosis, and have been observed in patients with sitosterolemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants fail to secrete cholesterol into bile and exhibit increased plasma and tissue plant sterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,219,027 Y1687H probably benign Het
4930548H24Rik T A 5: 31,486,207 C94S probably benign Het
Acsf2 C G 11: 94,561,362 E451D probably benign Het
Adam34 A T 8: 43,651,622 S329T probably benign Het
Adamts16 A G 13: 70,777,480 I535T probably damaging Het
Atp6v0d2 A G 4: 19,881,451 F214S probably damaging Het
Btg4 A G 9: 51,116,568 T13A possibly damaging Het
Csmd1 A T 8: 16,697,923 S271T possibly damaging Het
Cul9 T C 17: 46,520,501 T1596A probably damaging Het
Cyp2a4 G A 7: 26,312,937 D382N probably benign Het
Dbh C T 2: 27,170,543 R244C probably benign Het
Dnajc2 T C 5: 21,761,691 K426R probably benign Het
Dock4 T A 12: 40,702,951 M428K possibly damaging Het
Duox2 A T 2: 122,289,563 M822K possibly damaging Het
E330009J07Rik A T 6: 40,418,612 H187Q probably benign Het
Golga5 T C 12: 102,472,299 V91A probably benign Het
Gpatch2l T C 12: 86,244,189 S49P probably damaging Het
Ints7 T A 1: 191,596,353 L246* probably null Het
Kntc1 A G 5: 123,782,896 T926A possibly damaging Het
Kyat1 T C 2: 30,191,966 T54A probably benign Het
Megf6 C G 4: 154,252,518 C359W probably damaging Het
Mlh3 A G 12: 85,260,798 probably null Het
Neb C A 2: 52,235,479 probably null Het
Nyap2 A T 1: 81,192,131 Q201L probably benign Het
Pibf1 T G 14: 99,186,561 H523Q probably benign Het
Piezo1 A G 8: 122,506,097 S133P Het
Pnmal2 T C 7: 16,946,590 C500R probably benign Het
Ptpra A G 2: 130,537,603 N359S probably damaging Het
Rce1 A T 19: 4,625,050 I112N probably damaging Het
Rmdn1 T C 4: 19,586,853 Y104H probably benign Het
Snx22 A T 9: 66,068,198 D96E probably benign Het
Sox5 G T 6: 144,028,288 Q245K probably damaging Het
Stat6 A G 10: 127,646,973 D21G possibly damaging Het
Tbc1d15 T C 10: 115,229,140 Y180C probably damaging Het
Tdrd6 T C 17: 43,622,135 T2058A probably damaging Het
Thbs4 A T 13: 92,774,844 V277E probably benign Het
Tmem255b A G 8: 13,454,225 D139G probably damaging Het
Ttc27 C A 17: 74,717,964 T18K probably benign Het
Zfp131 A G 13: 119,775,812 F337L probably damaging Het
Other mutations in Abcg8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Abcg8 APN 17 84688529 splice site probably null
IGL01019:Abcg8 APN 17 84691995 missense probably benign 0.21
IGL02498:Abcg8 APN 17 84683265 missense probably benign
IGL02506:Abcg8 APN 17 84692488 missense possibly damaging 0.84
IGL03077:Abcg8 APN 17 84691880 missense probably damaging 1.00
R0086:Abcg8 UTSW 17 84692771 missense probably damaging 1.00
R0130:Abcg8 UTSW 17 84686666 missense probably damaging 1.00
R0930:Abcg8 UTSW 17 84683277 missense probably benign 0.00
R1466:Abcg8 UTSW 17 84686727 splice site probably benign
R1493:Abcg8 UTSW 17 84696679 missense probably damaging 1.00
R1628:Abcg8 UTSW 17 84691991 nonsense probably null
R1916:Abcg8 UTSW 17 84688530 critical splice acceptor site probably null
R1935:Abcg8 UTSW 17 84694989 splice site probably benign
R1971:Abcg8 UTSW 17 84695159 splice site probably benign
R4638:Abcg8 UTSW 17 84691941 missense probably damaging 1.00
R4693:Abcg8 UTSW 17 84696697 missense probably damaging 1.00
R5182:Abcg8 UTSW 17 84692744 missense probably damaging 1.00
R5227:Abcg8 UTSW 17 84691821 missense probably damaging 1.00
R5621:Abcg8 UTSW 17 84695993 missense probably damaging 0.96
R5772:Abcg8 UTSW 17 84686699 missense probably damaging 1.00
R7315:Abcg8 UTSW 17 84696714 missense probably damaging 0.99
R7709:Abcg8 UTSW 17 84692491 missense probably damaging 0.99
R7951:Abcg8 UTSW 17 84697529 missense probably damaging 1.00
Z1177:Abcg8 UTSW 17 84692006 missense possibly damaging 0.95
Z1177:Abcg8 UTSW 17 84695030 nonsense probably null
Z1177:Abcg8 UTSW 17 84696118 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAGGTGGAAGACGTAATCG -3'
(R):5'- TTGCTATAGCGAGGACAAGG -3'

Sequencing Primer
(F):5'- AGACGTAATCGCCGAGCTG -3'
(R):5'- GGTGGCCAATGGATGTGAAGTAC -3'
Posted On2020-07-13