Incidental Mutation 'R8231:Stat6'
ID637151
Institutional Source Beutler Lab
Gene Symbol Stat6
Ensembl Gene ENSMUSG00000002147
Gene Namesignal transducer and activator of transcription 6
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.778) question?
Stock #R8231 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location127642986-127660957 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127646973 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 21 (D21G)
Ref Sequence ENSEMBL: ENSMUSP00000089708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092074] [ENSMUST00000120279]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092074
AA Change: D21G

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000089708
Gene: ENSMUSG00000002147
AA Change: D21G

DomainStartEndE-ValueType
STAT_int 2 116 2.76e-31 SMART
Pfam:STAT_bind 273 526 4.4e-87 PFAM
SH2 540 622 1.33e-5 SMART
Pfam:STAT6_C 655 837 1.1e-94 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120279
AA Change: D21G

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112722
Gene: ENSMUSG00000002147
AA Change: D21G

DomainStartEndE-ValueType
Pfam:STAT_int 2 109 2.7e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein plays a central role in exerting IL4 mediated biological responses. It is found to induce the expression of BCL2L1/BCL-X(L), which is responsible for the anti-apoptotic activity of IL4. Knockout studies in mice suggested the roles of this gene in differentiation of T helper 2 (Th2) cells, expression of cell surface markers, and class switch of immunoglobulins. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired IL4 responses, including anti-IgM stimulated B cell proliferation, class switching to IgE, contact sensitivity, and Th2 cytokine production, and show increased resistance to certain infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,219,027 Y1687H probably benign Het
4930548H24Rik T A 5: 31,486,207 C94S probably benign Het
Abcg8 C T 17: 84,692,785 R258C probably damaging Het
Acsf2 C G 11: 94,561,362 E451D probably benign Het
Adam34 A T 8: 43,651,622 S329T probably benign Het
Adamts16 A G 13: 70,777,480 I535T probably damaging Het
Atp6v0d2 A G 4: 19,881,451 F214S probably damaging Het
Btg4 A G 9: 51,116,568 T13A possibly damaging Het
Csmd1 A T 8: 16,697,923 S271T possibly damaging Het
Cul9 T C 17: 46,520,501 T1596A probably damaging Het
Cyp2a4 G A 7: 26,312,937 D382N probably benign Het
Dbh C T 2: 27,170,543 R244C probably benign Het
Dnajc2 T C 5: 21,761,691 K426R probably benign Het
Dock4 T A 12: 40,702,951 M428K possibly damaging Het
Duox2 A T 2: 122,289,563 M822K possibly damaging Het
E330009J07Rik A T 6: 40,418,612 H187Q probably benign Het
Golga5 T C 12: 102,472,299 V91A probably benign Het
Gpatch2l T C 12: 86,244,189 S49P probably damaging Het
Ints7 T A 1: 191,596,353 L246* probably null Het
Kntc1 A G 5: 123,782,896 T926A possibly damaging Het
Kyat1 T C 2: 30,191,966 T54A probably benign Het
Megf6 C G 4: 154,252,518 C359W probably damaging Het
Mlh3 A G 12: 85,260,798 probably null Het
Neb C A 2: 52,235,479 probably null Het
Nyap2 A T 1: 81,192,131 Q201L probably benign Het
Pibf1 T G 14: 99,186,561 H523Q probably benign Het
Piezo1 A G 8: 122,506,097 S133P Het
Pnmal2 T C 7: 16,946,590 C500R probably benign Het
Ptpra A G 2: 130,537,603 N359S probably damaging Het
Rce1 A T 19: 4,625,050 I112N probably damaging Het
Rmdn1 T C 4: 19,586,853 Y104H probably benign Het
Snx22 A T 9: 66,068,198 D96E probably benign Het
Sox5 G T 6: 144,028,288 Q245K probably damaging Het
Tbc1d15 T C 10: 115,229,140 Y180C probably damaging Het
Tdrd6 T C 17: 43,622,135 T2058A probably damaging Het
Thbs4 A T 13: 92,774,844 V277E probably benign Het
Tmem255b A G 8: 13,454,225 D139G probably damaging Het
Ttc27 C A 17: 74,717,964 T18K probably benign Het
Zfp131 A G 13: 119,775,812 F337L probably damaging Het
Other mutations in Stat6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Stat6 APN 10 127654932 missense probably damaging 1.00
IGL01785:Stat6 APN 10 127657227 missense probably damaging 1.00
IGL02939:Stat6 APN 10 127646940 missense probably benign 0.05
IGL03266:Stat6 APN 10 127657155 missense possibly damaging 0.88
IGL03412:Stat6 APN 10 127658205 missense probably benign 0.00
Rigid UTSW 10 127658702 critical splice donor site probably null
Stationary UTSW 10 127652222 missense possibly damaging 0.93
PIT4142001:Stat6 UTSW 10 127658230 missense possibly damaging 0.95
R0165:Stat6 UTSW 10 127657227 missense probably damaging 0.98
R0581:Stat6 UTSW 10 127648116 missense probably damaging 0.99
R0735:Stat6 UTSW 10 127658241 missense probably damaging 1.00
R1333:Stat6 UTSW 10 127651225 missense possibly damaging 0.62
R1352:Stat6 UTSW 10 127650811 missense probably benign 0.32
R1457:Stat6 UTSW 10 127658245 missense probably damaging 0.98
R1538:Stat6 UTSW 10 127653256 missense probably damaging 1.00
R1696:Stat6 UTSW 10 127653049 missense probably damaging 1.00
R2016:Stat6 UTSW 10 127650796 missense probably damaging 1.00
R3236:Stat6 UTSW 10 127652222 missense possibly damaging 0.93
R3980:Stat6 UTSW 10 127655379 missense probably damaging 1.00
R4467:Stat6 UTSW 10 127651228 missense probably damaging 1.00
R5346:Stat6 UTSW 10 127652313 missense probably benign 0.44
R5481:Stat6 UTSW 10 127647826 splice site probably null
R5722:Stat6 UTSW 10 127658373 missense probably benign 0.00
R6036:Stat6 UTSW 10 127655444 missense possibly damaging 0.58
R6036:Stat6 UTSW 10 127655444 missense possibly damaging 0.58
R6244:Stat6 UTSW 10 127657712 splice site probably null
R6914:Stat6 UTSW 10 127651262 missense probably damaging 1.00
R6937:Stat6 UTSW 10 127658702 critical splice donor site probably null
R6942:Stat6 UTSW 10 127651262 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAAGGAGGTTCTCAGCAAG -3'
(R):5'- TCCTGGTTTAGCCTTCTAAGAGG -3'

Sequencing Primer
(F):5'- TCAGCAAGGCCATCTGTATG -3'
(R):5'- GCCTTCTAAGAGGTACAATGTCTAC -3'
Posted On2020-07-13