Incidental Mutation 'R8270:Fxyd5'
ID639441
Institutional Source Beutler Lab
Gene Symbol Fxyd5
Ensembl Gene ENSMUSG00000009687
Gene NameFXYD domain-containing ion transport regulator 5
SynonymsEF-8, Oit2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R8270 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location31032722-31042481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31041429 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 10 (L10P)
Ref Sequence ENSEMBL: ENSMUSP00000125173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009831] [ENSMUST00000073892] [ENSMUST00000159753] [ENSMUST00000159924] [ENSMUST00000160689] [ENSMUST00000161684] [ENSMUST00000161805] [ENSMUST00000162087] [ENSMUST00000162116] [ENSMUST00000162733] [ENSMUST00000202395] [ENSMUST00000206341]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009831
AA Change: L10P

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000009831
Gene: ENSMUSG00000009687
AA Change: L10P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 130 176 8.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073892
SMART Domains Protein: ENSMUSP00000073555
Gene: ENSMUSG00000036578

DomainStartEndE-ValueType
Pfam:ATP1G1_PLM_MAT8 13 60 1.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159753
AA Change: L10P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123813
Gene: ENSMUSG00000009687
AA Change: L10P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159924
AA Change: L10P

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124219
Gene: ENSMUSG00000009687
AA Change: L10P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160689
AA Change: L10P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125187
Gene: ENSMUSG00000009687
AA Change: L10P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161684
AA Change: L10P

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125285
Gene: ENSMUSG00000009687
AA Change: L10P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161805
AA Change: L10P

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125398
Gene: ENSMUSG00000009687
AA Change: L10P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162087
AA Change: L10P

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125065
Gene: ENSMUSG00000009687
AA Change: L10P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 130 174 1.5e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162116
AA Change: L10P

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124203
Gene: ENSMUSG00000009687
AA Change: L10P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162250
SMART Domains Protein: ENSMUSP00000124129
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 69 113 7.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162733
AA Change: L10P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125173
Gene: ENSMUSG00000009687
AA Change: L10P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 131 167 6.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202395
AA Change: L10P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144377
Gene: ENSMUSG00000009687
AA Change: L10P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 52 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206341
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a precursor protein that is member of the FXYD family of transmembrane glycoproteins. Like most members of the FXYD family, the encoded protein is a subunit of the sodium-potassium adenosine triphosphatase pump. FXYD family members have tissue-specific expression and differentially regulate the activity of this pump. The protein encoded by this gene also plays a role in cell adhesion and motility. The orthologous human protein inhibits epithelial cadherin, a calcium-dependent adhesion protein and is associated with cancer (promotes metastasis). Alternative splicing of this mouse gene results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,503,044 T3044I probably damaging Het
Apbb1ip C T 2: 22,874,992 P562S unknown Het
Arhgap44 A G 11: 65,022,034 M477T possibly damaging Het
Arhgef12 T C 9: 42,971,058 T1497A probably benign Het
Atp5h T C 11: 115,416,872 D91G probably damaging Het
Atp6v0a4 A G 6: 38,074,229 F405L probably damaging Het
Bicc1 T A 10: 70,932,108 T893S probably damaging Het
Cacna1i T A 15: 80,373,634 C1122S probably damaging Het
Capn7 A G 14: 31,358,679 E369G probably damaging Het
Cass4 T A 2: 172,427,669 L557Q probably damaging Het
Cdh5 A G 8: 104,113,040 I48V probably benign Het
Crisp3 T C 17: 40,235,922 K35R probably benign Het
Csde1 G A 3: 103,038,755 A22T possibly damaging Het
Ctse T C 1: 131,668,139 Y190H probably damaging Het
Cyp2d34 T A 15: 82,620,787 D24V possibly damaging Het
D630045J12Rik A T 6: 38,190,723 Y981* probably null Het
Dclre1a G A 19: 56,544,950 T404I possibly damaging Het
Dmc1 T C 15: 79,601,545 D23G probably damaging Het
Dnah8 C T 17: 30,840,713 T4429M probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fn3k A T 11: 121,439,311 M107L probably benign Het
Gm4922 C T 10: 18,784,012 D321N probably benign Het
Gm7714 T C 5: 88,282,524 V93A possibly damaging Het
Gm884 T C 11: 103,543,315 I3009M unknown Het
Gtf2h3 A G 5: 124,595,987 *310W probably null Het
Hapln2 G A 3: 88,023,544 T180I possibly damaging Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Iqgap1 A G 7: 80,730,127 V1166A probably damaging Het
Kcnk10 T C 12: 98,435,099 N439S Het
Klhl3 A T 13: 58,113,154 M15K Het
Klk1b26 A T 7: 44,016,120 T151S probably benign Het
Krtap5-1 C A 7: 142,296,462 C176F unknown Het
Krtap5-3 T A 7: 142,201,956 C177S unknown Het
Map1a T C 2: 121,299,020 F180L probably damaging Het
Mfap5 T C 6: 122,521,930 probably null Het
Nckap1 T A 2: 80,524,664 H638L possibly damaging Het
Olfr506 T A 7: 108,612,943 I212N probably benign Het
Olfr910 T G 9: 38,539,348 M151R noncoding transcript Het
Optc C T 1: 133,905,072 V97M probably benign Het
Piezo1 A G 8: 122,501,559 Y330H Het
Ppp1r12b G T 1: 134,876,148 N424K probably benign Het
Prdm5 T A 6: 65,936,074 F580L probably damaging Het
Prr27 A C 5: 87,846,312 K348N possibly damaging Het
Prr30 A G 14: 101,198,386 Y247H possibly damaging Het
Sec24d T C 3: 123,305,886 V336A possibly damaging Het
Serac1 A T 17: 6,050,758 L457H probably damaging Het
Serpina1f A G 12: 103,693,498 I175T probably damaging Het
Sspo A T 6: 48,449,963 H242L probably benign Het
Tcaf2 A T 6: 42,630,024 M332K probably benign Het
Tnrc6a T A 7: 123,170,071 N361K possibly damaging Het
Trim43b G T 9: 89,085,405 H393N possibly damaging Het
Ush2a T C 1: 188,444,641 L1334S probably benign Het
Usp35 T C 7: 97,312,344 E625G probably benign Het
Other mutations in Fxyd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01910:Fxyd5 APN 7 31035218 missense probably damaging 0.96
IGL01913:Fxyd5 APN 7 31035212 missense probably damaging 0.99
IGL02071:Fxyd5 APN 7 31040188 missense possibly damaging 0.46
IGL02800:Fxyd5 APN 7 31032979 missense possibly damaging 0.95
R1812:Fxyd5 UTSW 7 31037930 critical splice acceptor site probably null
R2362:Fxyd5 UTSW 7 31036471 missense probably benign 0.00
R3690:Fxyd5 UTSW 7 31036439 missense possibly damaging 0.95
R4279:Fxyd5 UTSW 7 31035386 missense probably null 1.00
R4786:Fxyd5 UTSW 7 31041482 unclassified probably benign
R6410:Fxyd5 UTSW 7 31035406 missense probably damaging 1.00
R6465:Fxyd5 UTSW 7 31037880 missense probably damaging 0.96
R7257:Fxyd5 UTSW 7 31035151 missense unknown
R7309:Fxyd5 UTSW 7 31035404 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTCCAAAGAGGGTGCTAC -3'
(R):5'- GATCAGCTCCTGGAAGAAGG -3'

Sequencing Primer
(F):5'- AGAGCCTGCCTCGCCAATC -3'
(R):5'- GGGATGGTGGCCTGAGAC -3'
Posted On2020-07-28