Incidental Mutation 'R8251:Kansl1'
ID 640253
Institutional Source Beutler Lab
Gene Symbol Kansl1
Ensembl Gene ENSMUSG00000018412
Gene Name KAT8 regulatory NSL complex subunit 1
Synonyms 1700081L11Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001081045.1; Ensembl: ENSMUST00000018556, ENSMUST00000035872, ENSMUST00000106971, ENSMUST00000106972, ENSMUST00000106974, ENSMUST00000106977, ENSMUST00000134266, ENSMUST00000166536

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8251 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 104333229-104468861 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104424360 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 284 (I284T)
Ref Sequence ENSEMBL: ENSMUSP00000102590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018556] [ENSMUST00000106971] [ENSMUST00000106972] [ENSMUST00000106977] [ENSMUST00000134266]
AlphaFold Q80TG1
Predicted Effect probably benign
Transcript: ENSMUST00000018556
AA Change: I284T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018556
Gene: ENSMUSG00000018412
AA Change: I284T

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 759 772 N/A INTRINSIC
PEHE 816 966 1.53e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106971
AA Change: I284T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102584
Gene: ENSMUSG00000018412
AA Change: I284T

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 822 835 N/A INTRINSIC
PEHE 879 1029 1.53e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106972
AA Change: I284T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102585
Gene: ENSMUSG00000018412
AA Change: I284T

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 822 835 N/A INTRINSIC
PEHE 879 1029 1.53e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106977
AA Change: I284T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102590
Gene: ENSMUSG00000018412
AA Change: I284T

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 759 772 N/A INTRINSIC
PEHE 816 966 1.53e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134266
SMART Domains Protein: ENSMUSP00000116367
Gene: ENSMUSG00000018412

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is a subunit of two protein complexes involved with histone acetylation, the MLL1 complex and the NSL1 complex. The corresponding protein in Drosophila interacts with K(lysine) acetyltransferase 8, which is also a subunit of both the MLL1 and NSL1 complexes. [provided by RefSeq, Jun 2012]
Allele List at MGI

All alleles(136) : Gene trapped(136)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019O17Rik A G 1: 86,427,214 N282D probably benign Het
Acad11 A T 9: 104,091,707 D463V possibly damaging Het
Adamtsl4 C T 3: 95,684,574 R68Q probably damaging Het
Ankrd12 A T 17: 65,984,559 M1293K possibly damaging Het
Arhgap21 T C 2: 20,849,410 T1724A probably benign Het
Cacna1s G T 1: 136,086,723 G623W probably damaging Het
Cenpe T A 3: 135,251,684 probably null Het
Cep85l A T 10: 53,281,354 I751N probably damaging Het
Corin T A 5: 72,356,926 D468V probably damaging Het
Ctsr A G 13: 61,162,778 V51A probably damaging Het
Dnah14 A C 1: 181,664,865 E1630A probably damaging Het
Dsg4 C A 18: 20,471,164 A896E probably damaging Het
Ear2 T C 14: 44,103,020 L45P probably benign Het
Fam132a T C 4: 155,966,459 I295T probably damaging Het
Fshr T G 17: 89,200,485 D43A probably benign Het
Gata6 G A 18: 11,054,670 G200S probably benign Het
Gnaq T A 19: 16,335,055 M227K probably damaging Het
Ifit1bl1 T C 19: 34,594,832 Q75R possibly damaging Het
Impg2 A G 16: 56,259,597 E479G possibly damaging Het
Ints7 C T 1: 191,621,433 P957L unknown Het
Jmjd1c T C 10: 67,239,289 V73A noncoding transcript Het
Kcnj9 A G 1: 172,326,522 S12P probably benign Het
Krt16 A G 11: 100,248,370 probably null Het
Lrguk A T 6: 34,116,439 T632S probably benign Het
Man2b1 G A 8: 85,095,129 V687M probably damaging Het
Mroh5 T C 15: 73,783,153 E653G probably benign Het
Nabp1 A T 1: 51,477,578 S44T probably benign Het
Nt5dc3 C A 10: 86,820,227 H256Q probably damaging Het
Olfr1254 A T 2: 89,789,223 I43N probably damaging Het
Olfr344 A C 2: 36,569,455 N286H probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Pkd2 T C 5: 104,498,487 V720A probably benign Het
Pnpla6 T A 8: 3,532,399 N706K probably benign Het
Polr1b C A 2: 129,123,166 P724Q probably damaging Het
Rbpjl A G 2: 164,413,934 E366G probably damaging Het
Runx1t1 A G 4: 13,846,947 T244A possibly damaging Het
Slitrk3 C T 3: 73,049,396 R681H possibly damaging Het
Slu7 A G 11: 43,439,301 Y185C probably damaging Het
Snupn T A 9: 56,980,853 F231L probably damaging Het
Srpk2 G A 5: 23,524,268 P458S probably benign Het
St3gal5 T A 6: 72,149,160 F330I probably benign Het
Taf3 T C 2: 9,918,151 D878G possibly damaging Het
Tmem126a T C 7: 90,450,886 I150V probably benign Het
Tmem2 T C 19: 21,807,401 V416A possibly damaging Het
Trbv21 A G 6: 41,202,606 probably benign Het
Vmn2r70 A T 7: 85,565,978 L116* probably null Het
Vps36 A G 8: 22,192,916 T16A probably benign Het
Wdr17 C A 8: 54,657,232 G837W probably damaging Het
Zfp397 T C 18: 23,960,304 V282A probably benign Het
Other mutations in Kansl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Kansl1 APN 11 104424466 missense probably damaging 0.96
IGL00658:Kansl1 APN 11 104357526 missense probably benign 0.10
IGL00688:Kansl1 APN 11 104425066 missense probably damaging 1.00
IGL01121:Kansl1 APN 11 104335596 missense probably benign 0.01
IGL01624:Kansl1 APN 11 104424552 missense probably benign 0.13
IGL02187:Kansl1 APN 11 104378831 splice site probably null
IGL02711:Kansl1 APN 11 104335575 missense probably damaging 1.00
IGL02965:Kansl1 APN 11 104335165 missense probably damaging 0.99
kansas UTSW 11 104424132 missense possibly damaging 0.94
wichita UTSW 11 104356767 missense possibly damaging 0.90
NA:Kansl1 UTSW 11 104342367 missense probably benign 0.09
R0399:Kansl1 UTSW 11 104424132 missense possibly damaging 0.94
R0611:Kansl1 UTSW 11 104338186 missense probably benign 0.31
R0665:Kansl1 UTSW 11 104343538 missense probably benign
R0667:Kansl1 UTSW 11 104343538 missense probably benign
R0747:Kansl1 UTSW 11 104342976 missense probably benign 0.00
R0865:Kansl1 UTSW 11 104424368 missense probably benign 0.08
R1479:Kansl1 UTSW 11 104342416 missense probably damaging 1.00
R1679:Kansl1 UTSW 11 104423996 missense probably damaging 1.00
R1818:Kansl1 UTSW 11 104342457 missense possibly damaging 0.80
R1922:Kansl1 UTSW 11 104343640 missense probably damaging 1.00
R1932:Kansl1 UTSW 11 104335097 missense probably damaging 0.99
R2105:Kansl1 UTSW 11 104335559 missense probably damaging 0.98
R2907:Kansl1 UTSW 11 104424460 missense possibly damaging 0.82
R3935:Kansl1 UTSW 11 104343543 missense possibly damaging 0.83
R3936:Kansl1 UTSW 11 104343543 missense possibly damaging 0.83
R4282:Kansl1 UTSW 11 104378689 missense probably benign 0.19
R4455:Kansl1 UTSW 11 104424358 missense possibly damaging 0.47
R4696:Kansl1 UTSW 11 104356767 missense possibly damaging 0.90
R4846:Kansl1 UTSW 11 104342972 missense possibly damaging 0.48
R4890:Kansl1 UTSW 11 104343042 missense probably benign
R4973:Kansl1 UTSW 11 104424321 missense probably damaging 1.00
R4975:Kansl1 UTSW 11 104335564 missense probably damaging 1.00
R5085:Kansl1 UTSW 11 104424342 missense probably damaging 1.00
R5227:Kansl1 UTSW 11 104356814 missense probably benign 0.19
R5310:Kansl1 UTSW 11 104424858 missense possibly damaging 0.95
R5652:Kansl1 UTSW 11 104338166 missense probably damaging 1.00
R5677:Kansl1 UTSW 11 104335148 missense probably benign 0.00
R5980:Kansl1 UTSW 11 104343637 missense possibly damaging 0.96
R6013:Kansl1 UTSW 11 104350639 missense probably benign 0.00
R6253:Kansl1 UTSW 11 104357526 missense probably benign 0.10
R7751:Kansl1 UTSW 11 104424064 missense probably benign 0.30
R7880:Kansl1 UTSW 11 104424153 missense probably damaging 1.00
R7888:Kansl1 UTSW 11 104342422 missense probably benign 0.00
R7935:Kansl1 UTSW 11 104424286 missense probably damaging 0.99
R9033:Kansl1 UTSW 11 104357530 missense probably benign 0.00
R9192:Kansl1 UTSW 11 104336316 missense probably damaging 1.00
R9494:Kansl1 UTSW 11 104356740 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGACTCACTGGCAGCTTTTCTC -3'
(R):5'- AGCACTGCAAACAAATCTTCTG -3'

Sequencing Primer
(F):5'- TTCGGGTCAACATCAACTGG -3'
(R):5'- GTTAATTCCATGGACCAGCCG -3'
Posted On 2020-07-28