Mutagenetix > Incidental Mutations

Incidental Mutation 'R7888:Kansl1'

609172

Institutional Source

Beutler Lab

Gene Symbol

Kansl1

Ensembl Gene

ENSMUSG00000018412

Gene Name

KAT8 regulatory NSL complex subunit 1

Synonyms

1700081L11Rik

Accession Numbers

Genbank: NM_001081045.1; Ensembl: ENSMUST00000018556, ENSMUST00000035872, ENSMUST00000106971, ENSMUST00000106972, ENSMUST00000106974, ENSMUST00000106977, ENSMUST00000134266, ENSMUST00000166536

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7888 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

104333229-104468861 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104342422 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 760 (T760A)

Ref Sequence

ENSEMBL: ENSMUSP00000102590 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018556] [ENSMUST00000106971] [ENSMUST00000106972] [ENSMUST00000106977]

Predicted Effect

probably benign
Transcript: ENSMUST00000018556
AA Change: T760A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000018556
Gene: ENSMUSG00000018412
AA Change: T760A

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	759	772	N/A	INTRINSIC
PEHE	816	966	1.53e-53	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106971
AA Change: T823A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000102584
Gene: ENSMUSG00000018412
AA Change: T823A

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	822	835	N/A	INTRINSIC
PEHE	879	1029	1.53e-53	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106972
AA Change: T823A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000102585
Gene: ENSMUSG00000018412
AA Change: T823A

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	822	835	N/A	INTRINSIC
PEHE	879	1029	1.53e-53	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106977
AA Change: T760A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000102590
Gene: ENSMUSG00000018412
AA Change: T760A

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	759	772	N/A	INTRINSIC
PEHE	816	966	1.53e-53	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is a subunit of two protein complexes involved with histone acetylation, the MLL1 complex and the NSL1 complex. The corresponding protein in Drosophila interacts with K(lysine) acetyltransferase 8, which is also a subunit of both the MLL1 and NSL1 complexes. [provided by RefSeq, Jun 2012]

Allele List at MGI

All alleles(136) : Gene trapped(136)

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox2	G	T	14: 8,246,415	Q459K	probably benign	Het
Ano3	T	A	2: 110,666,428	Y792F	probably damaging	Het
Aoc3	C	T	11: 101,332,497	H520Y	probably damaging	Het
Atp4b	A	G	8: 13,389,811	F137S	probably damaging	Het
Bcorl1	G	A	X: 48,361,607	V11M	unknown	Het
Blvrb	A	G	7: 27,465,734	T160A	probably damaging	Het
Brd2	G	A	17: 34,117,021	R73W	probably damaging	Het
Btaf1	A	G	19: 36,965,636	T306A	probably benign	Het
Ccdc154	G	A	17: 25,164,604	V212M	possibly damaging	Het
Ccdc40	A	G	11: 119,229,141	E3G	unknown	Het
Cenpb	T	A	2: 131,179,842	E12V	probably damaging	Het
Cnot8	T	C	11: 58,111,311	S57P	probably benign	Het
Cryba4	T	C	5: 112,251,052	E42G	probably benign	Het
Fam129b	T	A	2: 32,922,125	Y406*	probably null	Het
Fam72a	T	A	1: 131,528,840	I47N	probably damaging	Het
Itgb2	T	C	10: 77,564,644	V697A	probably benign	Het
Jakmip1	A	G	5: 37,104,864	N336D	probably damaging	Het
Lrrc37a	T	A	11: 103,501,481	E1039D	probably benign	Het
Mpz	T	C	1: 171,159,635		probably null	Het
Mtss1	A	T	15: 58,972,524	M82K	probably damaging	Het
Myo6	T	C	9: 80,296,665	S1063P	probably damaging	Het
Nsun6	T	A	2: 14,996,544	E400D	probably benign	Het
Olfr1057	C	A	2: 86,374,926	C162F	probably benign	Het
Olfr121	A	T	17: 37,751,997	N48Y	probably damaging	Het
Olfr1395	T	C	11: 49,148,439	Y61H	probably damaging	Het
Olfr221	A	G	14: 52,035,890	S74P	probably damaging	Het
Olfr364-ps1	A	T	2: 37,146,322	M37L	probably benign	Het
Olfr385	T	C	11: 73,589,528	D70G	probably damaging	Het
Olfr608	T	A	7: 103,470,799	Y253*	probably null	Het
Pfdn5	T	A	15: 102,328,589	V92E	probably damaging	Het
Pik3c2g	T	C	6: 139,896,744	V801A		Het
Psme2b	T	A	11: 48,945,575	T182S	possibly damaging	Het
Ptcd3	G	A	6: 71,883,447	A592V	probably damaging	Het
Rabgap1	T	A	2: 37,537,307	Y633*	probably null	Het
Rnf39	A	T	17: 36,947,241	T222S	probably damaging	Het
Scnn1g	A	G	7: 121,743,655	N277S	probably damaging	Het
Slc16a13	T	G	11: 70,218,980	I232L	possibly damaging	Het
Slco2b1	T	G	7: 99,688,843	R111S	unknown	Het
Sltm	C	G	9: 70,586,673	P802R	possibly damaging	Het
Tmc3	T	C	7: 83,600,009	W269R	probably damaging	Het
Vmn2r4	T	C	3: 64,406,522	E346G	probably damaging	Het
Vps52	A	G	17: 33,965,751	N666S	probably damaging	Het
Wdfy4	C	T	14: 33,090,963	D1618N		Het
Zfp773	C	A	7: 7,132,979	C206F	probably benign	Het

Other mutations in Kansl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Kansl1	APN	11	104424466	missense	probably damaging	0.96
IGL00658:Kansl1	APN	11	104357526	missense	probably benign	0.10
IGL00688:Kansl1	APN	11	104425066	missense	probably damaging	1.00
IGL01121:Kansl1	APN	11	104335596	missense	probably benign	0.01
IGL01624:Kansl1	APN	11	104424552	missense	probably benign	0.13
IGL02187:Kansl1	APN	11	104378831	splice site	probably null
IGL02711:Kansl1	APN	11	104335575	missense	probably damaging	1.00
IGL02965:Kansl1	APN	11	104335165	missense	probably damaging	0.99
kansas	UTSW	11	104424132	missense	possibly damaging	0.94
wichita	UTSW	11	104356767	missense	possibly damaging	0.90
NA:Kansl1	UTSW	11	104342367	missense	probably benign	0.09
R0399:Kansl1	UTSW	11	104424132	missense	possibly damaging	0.94
R0611:Kansl1	UTSW	11	104338186	missense	probably benign	0.31
R0665:Kansl1	UTSW	11	104343538	missense	probably benign
R0667:Kansl1	UTSW	11	104343538	missense	probably benign
R0747:Kansl1	UTSW	11	104342976	missense	probably benign	0.00
R0865:Kansl1	UTSW	11	104424368	missense	probably benign	0.08
R1479:Kansl1	UTSW	11	104342416	missense	probably damaging	1.00
R1679:Kansl1	UTSW	11	104423996	missense	probably damaging	1.00
R1818:Kansl1	UTSW	11	104342457	missense	possibly damaging	0.80
R1922:Kansl1	UTSW	11	104343640	missense	probably damaging	1.00
R1932:Kansl1	UTSW	11	104335097	missense	probably damaging	0.99
R2105:Kansl1	UTSW	11	104335559	missense	probably damaging	0.98
R2907:Kansl1	UTSW	11	104424460	missense	possibly damaging	0.82
R3935:Kansl1	UTSW	11	104343543	missense	possibly damaging	0.83
R3936:Kansl1	UTSW	11	104343543	missense	possibly damaging	0.83
R4282:Kansl1	UTSW	11	104378689	missense	probably benign	0.19
R4455:Kansl1	UTSW	11	104424358	missense	possibly damaging	0.47
R4696:Kansl1	UTSW	11	104356767	missense	possibly damaging	0.90
R4846:Kansl1	UTSW	11	104342972	missense	possibly damaging	0.48
R4890:Kansl1	UTSW	11	104343042	missense	probably benign
R4973:Kansl1	UTSW	11	104424321	missense	probably damaging	1.00
R4975:Kansl1	UTSW	11	104335564	missense	probably damaging	1.00
R5085:Kansl1	UTSW	11	104424342	missense	probably damaging	1.00
R5227:Kansl1	UTSW	11	104356814	missense	probably benign	0.19
R5310:Kansl1	UTSW	11	104424858	missense	possibly damaging	0.95
R5652:Kansl1	UTSW	11	104338166	missense	probably damaging	1.00
R5677:Kansl1	UTSW	11	104335148	missense	probably benign	0.00
R5980:Kansl1	UTSW	11	104343637	missense	possibly damaging	0.96
R6013:Kansl1	UTSW	11	104350639	missense	probably benign	0.00
R6253:Kansl1	UTSW	11	104357526	missense	probably benign	0.10
R7751:Kansl1	UTSW	11	104424064	missense	probably benign	0.30
R7880:Kansl1	UTSW	11	104424153	missense	probably damaging	1.00
R7963:Kansl1	UTSW	11	104424153	missense	probably damaging	1.00
R7971:Kansl1	UTSW	11	104342422	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCAACTGTCTACCCATGACTTAG -3'
(R):5'- GTGTATATTGCTGGCCTTCCTAAC -3'

Sequencing Primer
(F):5'- TGTCTACCCATGACTTAGCAGAG -3'
(R):5'- GGCCTTCCTAACATATGTCAGAAGTC -3'

Posted On

2019-12-20