Incidental Mutation 'R7888:Kansl1'
ID609172
Institutional Source Beutler Lab
Gene Symbol Kansl1
Ensembl Gene ENSMUSG00000018412
Gene NameKAT8 regulatory NSL complex subunit 1
Synonyms1700081L11Rik
Accession Numbers

Genbank: NM_001081045.1; Ensembl: ENSMUST00000018556, ENSMUST00000035872, ENSMUST00000106971, ENSMUST00000106972, ENSMUST00000106974, ENSMUST00000106977, ENSMUST00000134266, ENSMUST00000166536

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7888 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location104333229-104468861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104342422 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 760 (T760A)
Ref Sequence ENSEMBL: ENSMUSP00000102590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018556] [ENSMUST00000106971] [ENSMUST00000106972] [ENSMUST00000106977]
Predicted Effect probably benign
Transcript: ENSMUST00000018556
AA Change: T760A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000018556
Gene: ENSMUSG00000018412
AA Change: T760A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 759 772 N/A INTRINSIC
PEHE 816 966 1.53e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106971
AA Change: T823A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102584
Gene: ENSMUSG00000018412
AA Change: T823A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 822 835 N/A INTRINSIC
PEHE 879 1029 1.53e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106972
AA Change: T823A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102585
Gene: ENSMUSG00000018412
AA Change: T823A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 822 835 N/A INTRINSIC
PEHE 879 1029 1.53e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106977
AA Change: T760A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102590
Gene: ENSMUSG00000018412
AA Change: T760A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 759 772 N/A INTRINSIC
PEHE 816 966 1.53e-53 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is a subunit of two protein complexes involved with histone acetylation, the MLL1 complex and the NSL1 complex. The corresponding protein in Drosophila interacts with K(lysine) acetyltransferase 8, which is also a subunit of both the MLL1 and NSL1 complexes. [provided by RefSeq, Jun 2012]
Allele List at MGI

All alleles(136) : Gene trapped(136)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 G T 14: 8,246,415 Q459K probably benign Het
Ano3 T A 2: 110,666,428 Y792F probably damaging Het
Aoc3 C T 11: 101,332,497 H520Y probably damaging Het
Atp4b A G 8: 13,389,811 F137S probably damaging Het
Bcorl1 G A X: 48,361,607 V11M unknown Het
Blvrb A G 7: 27,465,734 T160A probably damaging Het
Brd2 G A 17: 34,117,021 R73W probably damaging Het
Btaf1 A G 19: 36,965,636 T306A probably benign Het
Ccdc154 G A 17: 25,164,604 V212M possibly damaging Het
Ccdc40 A G 11: 119,229,141 E3G unknown Het
Cenpb T A 2: 131,179,842 E12V probably damaging Het
Cnot8 T C 11: 58,111,311 S57P probably benign Het
Cryba4 T C 5: 112,251,052 E42G probably benign Het
Fam129b T A 2: 32,922,125 Y406* probably null Het
Fam72a T A 1: 131,528,840 I47N probably damaging Het
Itgb2 T C 10: 77,564,644 V697A probably benign Het
Jakmip1 A G 5: 37,104,864 N336D probably damaging Het
Lrrc37a T A 11: 103,501,481 E1039D probably benign Het
Mpz T C 1: 171,159,635 probably null Het
Mtss1 A T 15: 58,972,524 M82K probably damaging Het
Myo6 T C 9: 80,296,665 S1063P probably damaging Het
Nsun6 T A 2: 14,996,544 E400D probably benign Het
Olfr1057 C A 2: 86,374,926 C162F probably benign Het
Olfr121 A T 17: 37,751,997 N48Y probably damaging Het
Olfr1395 T C 11: 49,148,439 Y61H probably damaging Het
Olfr221 A G 14: 52,035,890 S74P probably damaging Het
Olfr364-ps1 A T 2: 37,146,322 M37L probably benign Het
Olfr385 T C 11: 73,589,528 D70G probably damaging Het
Olfr608 T A 7: 103,470,799 Y253* probably null Het
Pfdn5 T A 15: 102,328,589 V92E probably damaging Het
Pik3c2g T C 6: 139,896,744 V801A Het
Psme2b T A 11: 48,945,575 T182S possibly damaging Het
Ptcd3 G A 6: 71,883,447 A592V probably damaging Het
Rabgap1 T A 2: 37,537,307 Y633* probably null Het
Rnf39 A T 17: 36,947,241 T222S probably damaging Het
Scnn1g A G 7: 121,743,655 N277S probably damaging Het
Slc16a13 T G 11: 70,218,980 I232L possibly damaging Het
Slco2b1 T G 7: 99,688,843 R111S unknown Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Tmc3 T C 7: 83,600,009 W269R probably damaging Het
Vmn2r4 T C 3: 64,406,522 E346G probably damaging Het
Vps52 A G 17: 33,965,751 N666S probably damaging Het
Wdfy4 C T 14: 33,090,963 D1618N Het
Zfp773 C A 7: 7,132,979 C206F probably benign Het
Other mutations in Kansl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Kansl1 APN 11 104424466 missense probably damaging 0.96
IGL00658:Kansl1 APN 11 104357526 missense probably benign 0.10
IGL00688:Kansl1 APN 11 104425066 missense probably damaging 1.00
IGL01121:Kansl1 APN 11 104335596 missense probably benign 0.01
IGL01624:Kansl1 APN 11 104424552 missense probably benign 0.13
IGL02187:Kansl1 APN 11 104378831 splice site probably null
IGL02711:Kansl1 APN 11 104335575 missense probably damaging 1.00
IGL02965:Kansl1 APN 11 104335165 missense probably damaging 0.99
kansas UTSW 11 104424132 missense possibly damaging 0.94
wichita UTSW 11 104356767 missense possibly damaging 0.90
NA:Kansl1 UTSW 11 104342367 missense probably benign 0.09
R0399:Kansl1 UTSW 11 104424132 missense possibly damaging 0.94
R0611:Kansl1 UTSW 11 104338186 missense probably benign 0.31
R0665:Kansl1 UTSW 11 104343538 missense probably benign
R0667:Kansl1 UTSW 11 104343538 missense probably benign
R0747:Kansl1 UTSW 11 104342976 missense probably benign 0.00
R0865:Kansl1 UTSW 11 104424368 missense probably benign 0.08
R1479:Kansl1 UTSW 11 104342416 missense probably damaging 1.00
R1679:Kansl1 UTSW 11 104423996 missense probably damaging 1.00
R1818:Kansl1 UTSW 11 104342457 missense possibly damaging 0.80
R1922:Kansl1 UTSW 11 104343640 missense probably damaging 1.00
R1932:Kansl1 UTSW 11 104335097 missense probably damaging 0.99
R2105:Kansl1 UTSW 11 104335559 missense probably damaging 0.98
R2907:Kansl1 UTSW 11 104424460 missense possibly damaging 0.82
R3935:Kansl1 UTSW 11 104343543 missense possibly damaging 0.83
R3936:Kansl1 UTSW 11 104343543 missense possibly damaging 0.83
R4282:Kansl1 UTSW 11 104378689 missense probably benign 0.19
R4455:Kansl1 UTSW 11 104424358 missense possibly damaging 0.47
R4696:Kansl1 UTSW 11 104356767 missense possibly damaging 0.90
R4846:Kansl1 UTSW 11 104342972 missense possibly damaging 0.48
R4890:Kansl1 UTSW 11 104343042 missense probably benign
R4973:Kansl1 UTSW 11 104424321 missense probably damaging 1.00
R4975:Kansl1 UTSW 11 104335564 missense probably damaging 1.00
R5085:Kansl1 UTSW 11 104424342 missense probably damaging 1.00
R5227:Kansl1 UTSW 11 104356814 missense probably benign 0.19
R5310:Kansl1 UTSW 11 104424858 missense possibly damaging 0.95
R5652:Kansl1 UTSW 11 104338166 missense probably damaging 1.00
R5677:Kansl1 UTSW 11 104335148 missense probably benign 0.00
R5980:Kansl1 UTSW 11 104343637 missense possibly damaging 0.96
R6013:Kansl1 UTSW 11 104350639 missense probably benign 0.00
R6253:Kansl1 UTSW 11 104357526 missense probably benign 0.10
R7751:Kansl1 UTSW 11 104424064 missense probably benign 0.30
R7880:Kansl1 UTSW 11 104424153 missense probably damaging 1.00
R7963:Kansl1 UTSW 11 104424153 missense probably damaging 1.00
R7971:Kansl1 UTSW 11 104342422 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAACTGTCTACCCATGACTTAG -3'
(R):5'- GTGTATATTGCTGGCCTTCCTAAC -3'

Sequencing Primer
(F):5'- TGTCTACCCATGACTTAGCAGAG -3'
(R):5'- GGCCTTCCTAACATATGTCAGAAGTC -3'
Posted On2019-12-20