Mutagenetix > Incidental Mutation

Incidental Mutation 'R8251:Arhgap21'

640223

Institutional Source

Beutler Lab

Gene Symbol

Arhgap21

Ensembl Gene

ENSMUSG00000036591

Gene Name

Rho GTPase activating protein 21

Synonyms

ARHGAP10, 5530401C11Rik

MMRRC Submission

067677-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.570) question?

Stock #

R8251 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20852730-20973692 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20854221 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1724 (T1724A)

Ref Sequence

ENSEMBL: ENSMUSP00000122497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000174584]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114594
AA Change: T1718A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: T1718A

Domain	Start	End	E-Value	Type
PDZ	58	159	1.03e-16	SMART
low complexity region	351	362	N/A	INTRINSIC
low complexity region	445	459	N/A	INTRINSIC
low complexity region	625	635	N/A	INTRINSIC
low complexity region	911	925	N/A	INTRINSIC
PH	930	1040	2.09e-16	SMART
RhoGAP	1157	1334	3.26e-62	SMART
low complexity region	1381	1399	N/A	INTRINSIC
low complexity region	1448	1466	N/A	INTRINSIC
low complexity region	1533	1565	N/A	INTRINSIC
low complexity region	1573	1593	N/A	INTRINSIC
low complexity region	1891	1900	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141298
AA Change: T1724A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: T1724A

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000154230
AA Change: T1724A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: T1724A

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173194
AA Change: T1714A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: T1714A

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	347	358	N/A	INTRINSIC
low complexity region	441	455	N/A	INTRINSIC
low complexity region	621	631	N/A	INTRINSIC
low complexity region	907	921	N/A	INTRINSIC
PH	926	1036	2.09e-16	SMART
RhoGAP	1153	1330	3.26e-62	SMART
low complexity region	1377	1395	N/A	INTRINSIC
low complexity region	1444	1462	N/A	INTRINSIC
low complexity region	1529	1561	N/A	INTRINSIC
low complexity region	1569	1589	N/A	INTRINSIC
low complexity region	1887	1896	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174584

SMART Domains

Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591

Domain	Start	End	E-Value	Type
low complexity region	186	197	N/A	INTRINSIC
low complexity region	280	294	N/A	INTRINSIC
low complexity region	460	470	N/A	INTRINSIC
low complexity region	746	760	N/A	INTRINSIC
PH	765	875	2.09e-16	SMART
RhoGAP	992	1169	3.26e-62	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad11	A	T	9: 103,968,906 (GRCm39)	D463V	possibly damaging	Het
Adamtsl4	C	T	3: 95,591,884 (GRCm39)	R68Q	probably damaging	Het
Ankrd12	A	T	17: 66,291,554 (GRCm39)	M1293K	possibly damaging	Het
C1qtnf12	T	C	4: 156,050,916 (GRCm39)	I295T	probably damaging	Het
Cacna1s	G	T	1: 136,014,461 (GRCm39)	G623W	probably damaging	Het
Cemip2	T	C	19: 21,784,765 (GRCm39)	V416A	possibly damaging	Het
Cenpe	T	A	3: 134,957,445 (GRCm39)		probably null	Het
Cep85l	A	T	10: 53,157,450 (GRCm39)	I751N	probably damaging	Het
Corin	T	A	5: 72,514,269 (GRCm39)	D468V	probably damaging	Het
Ctsr	A	G	13: 61,310,592 (GRCm39)	V51A	probably damaging	Het
Dnah14	A	C	1: 181,492,430 (GRCm39)	E1630A	probably damaging	Het
Dsg4	C	A	18: 20,604,221 (GRCm39)	A896E	probably damaging	Het
Ear2	T	C	14: 44,340,477 (GRCm39)	L45P	probably benign	Het
Fshr	T	G	17: 89,507,913 (GRCm39)	D43A	probably benign	Het
Gata6	G	A	18: 11,054,670 (GRCm39)	G200S	probably benign	Het
Gnaq	T	A	19: 16,312,419 (GRCm39)	M227K	probably damaging	Het
Ifit1bl1	T	C	19: 34,572,232 (GRCm39)	Q75R	possibly damaging	Het
Impg2	A	G	16: 56,079,960 (GRCm39)	E479G	possibly damaging	Het
Ints7	C	T	1: 191,353,545 (GRCm39)	P957L	unknown	Het
Jmjd1c	T	C	10: 67,075,068 (GRCm39)	V73A	noncoding transcript	Het
Kansl1	A	G	11: 104,315,186 (GRCm39)	I284T	probably benign	Het
Kcnj9	A	G	1: 172,154,089 (GRCm39)	S12P	probably benign	Het
Krt16	A	G	11: 100,139,196 (GRCm39)		probably null	Het
Lrguk	A	T	6: 34,093,374 (GRCm39)	T632S	probably benign	Het
Man2b1	G	A	8: 85,821,758 (GRCm39)	V687M	probably damaging	Het
Mroh5	T	C	15: 73,655,002 (GRCm39)	E653G	probably benign	Het
Nabp1	A	T	1: 51,516,737 (GRCm39)	S44T	probably benign	Het
Nt5dc3	C	A	10: 86,656,091 (GRCm39)	H256Q	probably damaging	Het
Or1j15	A	C	2: 36,459,467 (GRCm39)	N286H	probably damaging	Het
Or4a81	A	T	2: 89,619,567 (GRCm39)	I43N	probably damaging	Het
Or5p50	A	G	7: 107,421,776 (GRCm39)	I300T	probably damaging	Het
Pkd2	T	C	5: 104,646,353 (GRCm39)	V720A	probably benign	Het
Pnpla6	T	A	8: 3,582,399 (GRCm39)	N706K	probably benign	Het
Polr1b	C	A	2: 128,965,086 (GRCm39)	P724Q	probably damaging	Het
Rbpjl	A	G	2: 164,255,854 (GRCm39)	E366G	probably damaging	Het
Runx1t1	A	G	4: 13,846,947 (GRCm39)	T244A	possibly damaging	Het
Slitrk3	C	T	3: 72,956,729 (GRCm39)	R681H	possibly damaging	Het
Slu7	A	G	11: 43,330,128 (GRCm39)	Y185C	probably damaging	Het
Snupn	T	A	9: 56,888,137 (GRCm39)	F231L	probably damaging	Het
Srpk2	G	A	5: 23,729,266 (GRCm39)	P458S	probably benign	Het
St3gal5	T	A	6: 72,126,144 (GRCm39)	F330I	probably benign	Het
Taf3	T	C	2: 9,922,962 (GRCm39)	D878G	possibly damaging	Het
Tex44	A	G	1: 86,354,936 (GRCm39)	N282D	probably benign	Het
Tmem126a	T	C	7: 90,100,094 (GRCm39)	I150V	probably benign	Het
Trbv21	A	G	6: 41,179,540 (GRCm39)		probably benign	Het
Vmn2r70	A	T	7: 85,215,186 (GRCm39)	L116*	probably null	Het
Vps36	A	G	8: 22,682,932 (GRCm39)	T16A	probably benign	Het
Wdr17	C	A	8: 55,110,267 (GRCm39)	G837W	probably damaging	Het
Zfp397	T	C	18: 24,093,361 (GRCm39)	V282A	probably benign	Het

Other mutations in Arhgap21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Arhgap21	APN	2	20,860,511 (GRCm39)	missense	probably damaging	1.00
IGL01472:Arhgap21	APN	2	20,854,392 (GRCm39)	missense	probably damaging	1.00
IGL01634:Arhgap21	APN	2	20,919,455 (GRCm39)	missense	probably benign	0.00
IGL01766:Arhgap21	APN	2	20,854,448 (GRCm39)	missense	possibly damaging	0.68
IGL02097:Arhgap21	APN	2	20,884,813 (GRCm39)	missense	probably benign	0.39
IGL02197:Arhgap21	APN	2	20,885,117 (GRCm39)	missense	probably benign
IGL02264:Arhgap21	APN	2	20,864,850 (GRCm39)	splice site	probably null
IGL02346:Arhgap21	APN	2	20,884,762 (GRCm39)	splice site	probably benign
IGL02418:Arhgap21	APN	2	20,885,711 (GRCm39)	missense	probably damaging	1.00
IGL02605:Arhgap21	APN	2	20,860,399 (GRCm39)	missense	probably damaging	1.00
IGL02701:Arhgap21	APN	2	20,896,902 (GRCm39)	missense	probably damaging	1.00
IGL03019:Arhgap21	APN	2	20,865,874 (GRCm39)	missense	probably damaging	1.00
IGL03085:Arhgap21	APN	2	20,919,532 (GRCm39)	missense	probably benign
IGL03265:Arhgap21	APN	2	20,854,439 (GRCm39)	missense	probably benign	0.03
IGL03379:Arhgap21	APN	2	20,885,500 (GRCm39)	missense	probably benign	0.41
R0304:Arhgap21	UTSW	2	20,864,612 (GRCm39)	splice site	probably benign
R0363:Arhgap21	UTSW	2	20,885,944 (GRCm39)	missense	probably damaging	1.00
R0498:Arhgap21	UTSW	2	20,867,928 (GRCm39)	missense	probably damaging	1.00
R0539:Arhgap21	UTSW	2	20,919,610 (GRCm39)	nonsense	probably null
R0633:Arhgap21	UTSW	2	20,860,198 (GRCm39)	nonsense	probably null
R0905:Arhgap21	UTSW	2	20,854,745 (GRCm39)	missense	possibly damaging	0.88
R1550:Arhgap21	UTSW	2	20,886,576 (GRCm39)	nonsense	probably null
R1570:Arhgap21	UTSW	2	20,885,651 (GRCm39)	missense	probably benign
R1686:Arhgap21	UTSW	2	20,886,659 (GRCm39)	missense	probably damaging	1.00
R1746:Arhgap21	UTSW	2	20,865,910 (GRCm39)	missense	probably damaging	0.99
R1864:Arhgap21	UTSW	2	20,866,015 (GRCm39)	missense	probably damaging	1.00
R1865:Arhgap21	UTSW	2	20,866,015 (GRCm39)	missense	probably damaging	1.00
R2209:Arhgap21	UTSW	2	20,854,331 (GRCm39)	missense	probably damaging	1.00
R2211:Arhgap21	UTSW	2	20,886,451 (GRCm39)	missense	possibly damaging	0.56
R2276:Arhgap21	UTSW	2	20,868,037 (GRCm39)	missense	possibly damaging	0.94
R2277:Arhgap21	UTSW	2	20,868,037 (GRCm39)	missense	possibly damaging	0.94
R2279:Arhgap21	UTSW	2	20,868,037 (GRCm39)	missense	possibly damaging	0.94
R2336:Arhgap21	UTSW	2	20,884,862 (GRCm39)	missense	probably damaging	1.00
R2516:Arhgap21	UTSW	2	20,859,809 (GRCm39)	missense	probably damaging	1.00
R3722:Arhgap21	UTSW	2	20,855,102 (GRCm39)	missense	probably damaging	1.00
R3877:Arhgap21	UTSW	2	20,864,717 (GRCm39)	missense	probably damaging	0.99
R4017:Arhgap21	UTSW	2	20,896,915 (GRCm39)	missense	probably benign	0.10
R4232:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4233:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4234:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4235:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4236:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4434:Arhgap21	UTSW	2	20,972,146 (GRCm39)	missense	probably benign
R4686:Arhgap21	UTSW	2	20,868,033 (GRCm39)	missense	probably damaging	1.00
R4817:Arhgap21	UTSW	2	20,854,967 (GRCm39)	missense	probably benign
R4834:Arhgap21	UTSW	2	20,870,130 (GRCm39)	missense	probably damaging	1.00
R4845:Arhgap21	UTSW	2	20,885,998 (GRCm39)	missense	probably damaging	0.99
R4889:Arhgap21	UTSW	2	20,885,279 (GRCm39)	missense	probably benign	0.10
R4904:Arhgap21	UTSW	2	20,854,872 (GRCm39)	missense	probably benign	0.00
R4911:Arhgap21	UTSW	2	20,863,800 (GRCm39)	missense	probably damaging	1.00
R4994:Arhgap21	UTSW	2	20,854,701 (GRCm39)	missense	probably benign	0.00
R5067:Arhgap21	UTSW	2	20,884,848 (GRCm39)	missense	probably damaging	1.00
R5086:Arhgap21	UTSW	2	20,853,645 (GRCm39)	missense	probably benign	0.00
R5281:Arhgap21	UTSW	2	20,854,127 (GRCm39)	missense	probably damaging	1.00
R5364:Arhgap21	UTSW	2	20,854,533 (GRCm39)	missense	probably damaging	1.00
R5420:Arhgap21	UTSW	2	20,885,897 (GRCm39)	missense	probably damaging	0.99
R5476:Arhgap21	UTSW	2	20,885,497 (GRCm39)	missense	probably benign	0.06
R5831:Arhgap21	UTSW	2	20,868,024 (GRCm39)	missense	probably damaging	1.00
R5949:Arhgap21	UTSW	2	20,853,852 (GRCm39)	missense	probably damaging	0.97
R5994:Arhgap21	UTSW	2	20,886,187 (GRCm39)	missense	possibly damaging	0.78
R6014:Arhgap21	UTSW	2	20,886,616 (GRCm39)	missense	probably damaging	1.00
R6739:Arhgap21	UTSW	2	20,885,543 (GRCm39)	missense	possibly damaging	0.94
R6817:Arhgap21	UTSW	2	20,885,107 (GRCm39)	missense	probably benign	0.23
R6821:Arhgap21	UTSW	2	20,853,659 (GRCm39)	missense	probably benign
R6844:Arhgap21	UTSW	2	20,886,116 (GRCm39)	missense	probably benign	0.00
R6870:Arhgap21	UTSW	2	20,885,321 (GRCm39)	missense	probably damaging	1.00
R6891:Arhgap21	UTSW	2	20,855,142 (GRCm39)	missense	probably damaging	0.97
R7011:Arhgap21	UTSW	2	20,853,689 (GRCm39)	missense	possibly damaging	0.65
R7144:Arhgap21	UTSW	2	20,870,198 (GRCm39)	missense	probably benign
R7237:Arhgap21	UTSW	2	20,854,783 (GRCm39)	nonsense	probably null
R7261:Arhgap21	UTSW	2	20,885,177 (GRCm39)	missense	probably benign
R7558:Arhgap21	UTSW	2	20,860,421 (GRCm39)	missense	probably damaging	1.00
R7566:Arhgap21	UTSW	2	20,917,102 (GRCm39)	missense	probably benign	0.17
R7738:Arhgap21	UTSW	2	20,855,169 (GRCm39)	missense	probably damaging	1.00
R7738:Arhgap21	UTSW	2	20,854,290 (GRCm39)	missense	probably damaging	1.00
R7820:Arhgap21	UTSW	2	20,867,983 (GRCm39)	missense	probably damaging	1.00
R7822:Arhgap21	UTSW	2	20,885,524 (GRCm39)	missense	possibly damaging	0.80
R7965:Arhgap21	UTSW	2	20,854,007 (GRCm39)	missense	probably damaging	1.00
R7986:Arhgap21	UTSW	2	20,867,967 (GRCm39)	missense	probably damaging	1.00
R8028:Arhgap21	UTSW	2	20,885,216 (GRCm39)	missense	probably benign	0.02
R8209:Arhgap21	UTSW	2	20,876,556 (GRCm39)	missense	probably damaging	1.00
R8226:Arhgap21	UTSW	2	20,876,556 (GRCm39)	missense	probably damaging	1.00
R8486:Arhgap21	UTSW	2	20,865,236 (GRCm39)	missense	probably damaging	1.00
R8487:Arhgap21	UTSW	2	20,886,116 (GRCm39)	missense	probably benign	0.08
R8508:Arhgap21	UTSW	2	20,858,991 (GRCm39)	missense	probably benign	0.17
R8835:Arhgap21	UTSW	2	20,972,144 (GRCm39)	nonsense	probably null
R9140:Arhgap21	UTSW	2	20,886,025 (GRCm39)	missense	probably damaging	1.00
R9190:Arhgap21	UTSW	2	20,858,983 (GRCm39)	missense	probably null	0.04
R9204:Arhgap21	UTSW	2	20,885,816 (GRCm39)	missense	probably damaging	1.00
R9227:Arhgap21	UTSW	2	20,860,469 (GRCm39)	missense	possibly damaging	0.92
R9230:Arhgap21	UTSW	2	20,860,469 (GRCm39)	missense	possibly damaging	0.92
R9308:Arhgap21	UTSW	2	20,854,061 (GRCm39)	missense	probably damaging	0.99
R9374:Arhgap21	UTSW	2	20,886,397 (GRCm39)	missense	probably damaging	1.00
R9449:Arhgap21	UTSW	2	20,885,464 (GRCm39)	missense	probably benign
R9454:Arhgap21	UTSW	2	20,870,153 (GRCm39)	missense	probably damaging	0.99
R9499:Arhgap21	UTSW	2	20,886,397 (GRCm39)	missense	probably damaging	1.00
R9544:Arhgap21	UTSW	2	20,858,938 (GRCm39)	missense	possibly damaging	0.73
R9552:Arhgap21	UTSW	2	20,886,397 (GRCm39)	missense	probably damaging	1.00
R9567:Arhgap21	UTSW	2	20,896,953 (GRCm39)	missense	possibly damaging	0.94
R9588:Arhgap21	UTSW	2	20,858,938 (GRCm39)	missense	possibly damaging	0.73
R9749:Arhgap21	UTSW	2	20,854,026 (GRCm39)	missense	probably benign	0.00
Z1191:Arhgap21	UTSW	2	20,886,283 (GRCm39)	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- TTGATTCCCAACTCCAAACATGTC -3'
(R):5'- GGCTGTTCCGAGGAAAATTC -3'

Sequencing Primer
(F):5'- TCCAAACATGTCGTCTGCGG -3'
(R):5'- ATTCCAGGAGGTTGCCAGG -3'

Posted On

2020-07-28