Incidental Mutation 'R8319:Ndufaf1'
ID641839
Institutional Source Beutler Lab
Gene Symbol Ndufaf1
Ensembl Gene ENSMUSG00000027305
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1
SynonymsCGI-65, 2410001M24Rik, CIA30
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R8319 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location119655446-119662827 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119660087 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 166 (L166P)
Ref Sequence ENSEMBL: ENSMUSP00000028768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028768] [ENSMUST00000110801] [ENSMUST00000110802]
Predicted Effect probably damaging
Transcript: ENSMUST00000028768
AA Change: L166P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028768
Gene: ENSMUSG00000027305
AA Change: L166P

DomainStartEndE-ValueType
Pfam:CIA30 128 301 3e-51 PFAM
Pfam:CBM_11 193 315 1.7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110801
AA Change: L164P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106425
Gene: ENSMUSG00000027305
AA Change: L164P

DomainStartEndE-ValueType
Pfam:CIA30 126 299 1.1e-47 PFAM
Pfam:CBM_11 127 312 1.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110802
AA Change: L164P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106426
Gene: ENSMUSG00000027305
AA Change: L164P

DomainStartEndE-ValueType
Pfam:CIA30 126 299 1.1e-47 PFAM
Pfam:CBM_11 127 312 1.3e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a complex I assembly factor protein. Complex I (NADH-ubiquinone oxidoreductase) catalyzes the transfer of electrons from NADH to ubiquinone (coenzyme Q) in the first step of the mitochondrial respiratory chain, resulting in the translocation of protons across the inner mitochondrial membrane. The encoded protein is required for assembly of complex I, and mutations in this gene are a cause of mitochondrial complex I deficiency. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,672 D115E probably benign Het
Abcc1 T A 16: 14,396,451 L197Q probably damaging Het
Adamts14 T G 10: 61,221,927 N547T probably benign Het
Ampd3 T A 7: 110,795,775 S301R probably benign Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
Atl1 A T 12: 69,955,319 T351S probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1c T C 6: 118,637,774 I1315V Het
Ccdc109b A G 3: 129,933,679 F93L probably damaging Het
Col12a1 C T 9: 79,648,697 G2013R probably damaging Het
Cpne2 A G 8: 94,553,412 D153G probably benign Het
Cryzl1 T C 16: 91,692,363 S205G probably benign Het
Cux1 C T 5: 136,565,397 A5T probably benign Het
Ddx60 T C 8: 61,942,635 probably null Het
Dnajc13 G A 9: 104,190,391 P1190S probably benign Het
Fbxw7 T A 3: 84,974,552 V526E Het
Fig4 C A 10: 41,263,101 G369C probably damaging Het
Gabra1 C T 11: 42,135,488 A326T probably damaging Het
Gbe1 G A 16: 70,488,076 G429S probably benign Het
Gm340 T A 19: 41,582,904 S179T probably damaging Het
Gtf3c5 A T 2: 28,570,494 H364Q probably benign Het
Hcfc2 T A 10: 82,738,367 I125N probably damaging Het
Hnrnpul1 A T 7: 25,754,477 D53E probably benign Het
Il18 A T 9: 50,581,518 D128V possibly damaging Het
Intu T A 3: 40,653,772 S71R probably damaging Het
Klhl6 T C 16: 19,957,190 E206G possibly damaging Het
Mdga2 T C 12: 67,221,029 Y5C unknown Het
Naip1 C A 13: 100,429,213 V354L probably benign Het
Naip5 A G 13: 100,221,659 V1023A probably benign Het
Ninl A T 2: 150,959,907 L147H probably damaging Het
Olfr1259 A G 2: 89,943,680 V145A possibly damaging Het
Olfr64 A G 7: 103,893,429 I102T probably damaging Het
Otogl C T 10: 107,853,266 probably null Het
Otulin AT ATT 15: 27,606,318 probably null Het
Phf11b A C 14: 59,338,697 L30R probably damaging Het
Prdm13 G T 4: 21,679,327 H388N unknown Het
Pwwp2b T C 7: 139,255,183 V180A probably damaging Het
Reep4 T A 14: 70,546,511 S23T probably damaging Het
Rusc2 T A 4: 43,425,378 L1161Q probably damaging Het
Scgb1b3 G A 7: 31,375,979 probably null Het
Scn10a G T 9: 119,670,389 N279K probably benign Het
Smurf2 A G 11: 106,824,752 L643S probably damaging Het
Sox12 G A 2: 152,397,272 P143S unknown Het
Specc1 C T 11: 62,118,675 T339I possibly damaging Het
Tas2r139 T C 6: 42,141,786 V284A probably benign Het
Thumpd3 T A 6: 113,063,146 C330* probably null Het
Ttc26 T A 6: 38,405,945 H338Q probably damaging Het
Ttn A G 2: 76,706,954 S34877P possibly damaging Het
Zfp568 T C 7: 29,998,204 S104P possibly damaging Het
Zfp933 G A 4: 147,828,453 H50Y possibly damaging Het
Other mutations in Ndufaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Ndufaf1 APN 2 119660469 missense probably damaging 1.00
IGL01871:Ndufaf1 APN 2 119658287 nonsense probably null
IGL02452:Ndufaf1 APN 2 119656426 missense probably damaging 1.00
IGL03087:Ndufaf1 APN 2 119655799 splice site probably benign
R1211:Ndufaf1 UTSW 2 119655675 missense probably damaging 1.00
R2420:Ndufaf1 UTSW 2 119655737 missense probably damaging 1.00
R2421:Ndufaf1 UTSW 2 119655737 missense probably damaging 1.00
R2422:Ndufaf1 UTSW 2 119655737 missense probably damaging 1.00
R3824:Ndufaf1 UTSW 2 119660271 missense probably benign 0.30
R4942:Ndufaf1 UTSW 2 119660066 missense possibly damaging 0.83
R5382:Ndufaf1 UTSW 2 119660412 missense possibly damaging 0.75
R5460:Ndufaf1 UTSW 2 119660477 missense probably benign 0.02
R5732:Ndufaf1 UTSW 2 119660040 nonsense probably null
R5777:Ndufaf1 UTSW 2 119660482 nonsense probably null
R5919:Ndufaf1 UTSW 2 119660228 missense possibly damaging 0.51
R6371:Ndufaf1 UTSW 2 119660053 missense probably damaging 1.00
R6378:Ndufaf1 UTSW 2 119655726 missense probably damaging 0.99
R7202:Ndufaf1 UTSW 2 119658426 missense probably benign 0.39
R7224:Ndufaf1 UTSW 2 119658396 missense probably damaging 1.00
R7847:Ndufaf1 UTSW 2 119660053 missense probably damaging 1.00
R8208:Ndufaf1 UTSW 2 119660346 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGCCAAGCAGTTACATACC -3'
(R):5'- GAAGGATGAAATTGTGGCTCATTTG -3'

Sequencing Primer
(F):5'- GCAGTTACATACCTCCTTATAAGGC -3'
(R):5'- TCATTTGAGAGGCCCAGACG -3'
Posted On2020-07-28