Incidental Mutation 'R8319:Hcfc2'
ID641868
Institutional Source Beutler Lab
Gene Symbol Hcfc2
Ensembl Gene ENSMUSG00000020246
Gene Namehost cell factor C2
Synonyms1700129L13Rik
Accession Numbers

Genbank: NM_001081218; MGI: 1915183

Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R8319 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location82696160-82742428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82738367 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 125 (I125N)
Ref Sequence ENSEMBL: ENSMUSP00000124489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020478] [ENSMUST00000160681]
Predicted Effect probably damaging
Transcript: ENSMUST00000020478
AA Change: I585N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020478
Gene: ENSMUSG00000020246
AA Change: I585N

DomainStartEndE-ValueType
Pfam:Kelch_1 22 60 2.1e-6 PFAM
Pfam:Kelch_5 68 106 1.1e-6 PFAM
Pfam:Kelch_3 81 135 8.8e-7 PFAM
Pfam:Kelch_5 186 230 8.4e-7 PFAM
Pfam:Kelch_3 206 253 1.6e-11 PFAM
Pfam:Kelch_1 244 302 7.5e-9 PFAM
Pfam:Kelch_3 254 323 3.4e-7 PFAM
Pfam:Kelch_5 312 356 1.4e-6 PFAM
FN3 357 591 8.43e-9 SMART
FN3 607 703 6.06e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160681
AA Change: I125N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124489
Gene: ENSMUSG00000020246
AA Change: I125N

DomainStartEndE-ValueType
FN3 52 131 1.22e1 SMART
FN3 147 243 6.06e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two proteins which interact with VP16, a herpes simplex virus protein that initiates virus infection. Both the encoded protein and the original Herpes host cell factor interact with VP16 through a beta-propeller domain. The original Herpes host cell factor, however, is effective at initiating viral infection while the encoded protein is not. Transcripts of varying length due to alternative polyadenylation signals have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null or severely hypomorphic allele exhibit reduced poly(I:C)-mediated TLR3 signaling and increased mortality following viral infection. [provided by MGI curators]
Allele List at MGI

none known

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,672 D115E probably benign Het
Abcc1 T A 16: 14,396,451 L197Q probably damaging Het
Adamts14 T G 10: 61,221,927 N547T probably benign Het
Ampd3 T A 7: 110,795,775 S301R probably benign Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
Atl1 A T 12: 69,955,319 T351S probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1c T C 6: 118,637,774 I1315V Het
Ccdc109b A G 3: 129,933,679 F93L probably damaging Het
Col12a1 C T 9: 79,648,697 G2013R probably damaging Het
Cpne2 A G 8: 94,553,412 D153G probably benign Het
Cryzl1 T C 16: 91,692,363 S205G probably benign Het
Cux1 C T 5: 136,565,397 A5T probably benign Het
Ddx60 T C 8: 61,942,635 probably null Het
Dnajc13 G A 9: 104,190,391 P1190S probably benign Het
Fbxw7 T A 3: 84,974,552 V526E Het
Fig4 C A 10: 41,263,101 G369C probably damaging Het
Gabra1 C T 11: 42,135,488 A326T probably damaging Het
Gbe1 G A 16: 70,488,076 G429S probably benign Het
Gm340 T A 19: 41,582,904 S179T probably damaging Het
Gtf3c5 A T 2: 28,570,494 H364Q probably benign Het
Hnrnpul1 A T 7: 25,754,477 D53E probably benign Het
Il18 A T 9: 50,581,518 D128V possibly damaging Het
Intu T A 3: 40,653,772 S71R probably damaging Het
Klhl6 T C 16: 19,957,190 E206G possibly damaging Het
Mdga2 T C 12: 67,221,029 Y5C unknown Het
Naip1 C A 13: 100,429,213 V354L probably benign Het
Naip5 A G 13: 100,221,659 V1023A probably benign Het
Ndufaf1 A G 2: 119,660,087 L166P probably damaging Het
Ninl A T 2: 150,959,907 L147H probably damaging Het
Olfr1259 A G 2: 89,943,680 V145A possibly damaging Het
Olfr64 A G 7: 103,893,429 I102T probably damaging Het
Otogl C T 10: 107,853,266 probably null Het
Otulin AT ATT 15: 27,606,318 probably null Het
Phf11b A C 14: 59,338,697 L30R probably damaging Het
Prdm13 G T 4: 21,679,327 H388N unknown Het
Pwwp2b T C 7: 139,255,183 V180A probably damaging Het
Reep4 T A 14: 70,546,511 S23T probably damaging Het
Rusc2 T A 4: 43,425,378 L1161Q probably damaging Het
Scgb1b3 G A 7: 31,375,979 probably null Het
Scn10a G T 9: 119,670,389 N279K probably benign Het
Smurf2 A G 11: 106,824,752 L643S probably damaging Het
Sox12 G A 2: 152,397,272 P143S unknown Het
Specc1 C T 11: 62,118,675 T339I possibly damaging Het
Tas2r139 T C 6: 42,141,786 V284A probably benign Het
Thumpd3 T A 6: 113,063,146 C330* probably null Het
Ttc26 T A 6: 38,405,945 H338Q probably damaging Het
Ttn A G 2: 76,706,954 S34877P possibly damaging Het
Zfp568 T C 7: 29,998,204 S104P possibly damaging Het
Zfp933 G A 4: 147,828,453 H50Y possibly damaging Het
Other mutations in Hcfc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Hcfc2 APN 10 82741278 splice site probably null
IGL01799:Hcfc2 APN 10 82700991 missense probably damaging 1.00
IGL01916:Hcfc2 APN 10 82734383 missense possibly damaging 0.94
IGL02150:Hcfc2 APN 10 82710018 missense probably damaging 1.00
IGL02378:Hcfc2 APN 10 82709071 missense possibly damaging 0.64
IGL02580:Hcfc2 APN 10 82728422 missense probably benign 0.00
IGL02641:Hcfc2 APN 10 82702549 missense probably damaging 1.00
Backstabbing UTSW 10 82711825 splice site probably null
feckless UTSW 10 82712061 missense probably damaging 1.00
Minions UTSW 10 82739245 missense probably damaging 1.00
scaffold UTSW 10 82738408 missense probably damaging 1.00
R0380:Hcfc2 UTSW 10 82728438 splice site probably benign
R0528:Hcfc2 UTSW 10 82739245 missense probably damaging 1.00
R0534:Hcfc2 UTSW 10 82738408 missense probably damaging 1.00
R1646:Hcfc2 UTSW 10 82701027 missense probably damaging 1.00
R1903:Hcfc2 UTSW 10 82702558 missense probably damaging 0.98
R1939:Hcfc2 UTSW 10 82702450 missense probably damaging 0.99
R2014:Hcfc2 UTSW 10 82738980 missense probably benign 0.23
R2015:Hcfc2 UTSW 10 82738980 missense probably benign 0.23
R2571:Hcfc2 UTSW 10 82709023 missense probably damaging 1.00
R4540:Hcfc2 UTSW 10 82732647 missense probably benign 0.10
R4694:Hcfc2 UTSW 10 82723700 missense probably damaging 1.00
R4735:Hcfc2 UTSW 10 82712080 missense probably damaging 1.00
R4833:Hcfc2 UTSW 10 82709146 missense probably null 0.01
R6837:Hcfc2 UTSW 10 82739196 missense probably damaging 0.96
R7268:Hcfc2 UTSW 10 82709012 nonsense probably null
R7683:Hcfc2 UTSW 10 82699229 missense probably benign 0.00
R7733:Hcfc2 UTSW 10 82739179 missense probably benign 0.00
R7742:Hcfc2 UTSW 10 82711825 splice site probably null
V3553:Hcfc2 UTSW 10 82712061 missense probably damaging 1.00
X0022:Hcfc2 UTSW 10 82709967 missense probably damaging 0.99
Z1176:Hcfc2 UTSW 10 82699172 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGAACTGGGTCCTTAAAATACACTC -3'
(R):5'- CCATGCATGGCTACTAAAACG -3'

Sequencing Primer
(F):5'- GTATTATATGTGCCTTTTCTCTG -3'
(R):5'- CATGCATGGCTACTAAAACGTTTAAC -3'
Posted On2020-07-28