Incidental Mutation 'R8387:Dab2ip'
ID647187
Institutional Source Beutler Lab
Gene Symbol Dab2ip
Ensembl Gene ENSMUSG00000026883
Gene Namedisabled 2 interacting protein
Synonyms2310011D08Rik, AIP1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #R8387 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location35558266-35730994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35719858 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 695 (I695K)
Ref Sequence ENSEMBL: ENSMUSP00000088532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065001] [ENSMUST00000091010] [ENSMUST00000112983] [ENSMUST00000112986] [ENSMUST00000112987] [ENSMUST00000112992] [ENSMUST00000135741] [ENSMUST00000145698]
Predicted Effect probably damaging
Transcript: ENSMUST00000065001
AA Change: I630K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068832
Gene: ENSMUSG00000026883
AA Change: I630K

DomainStartEndE-ValueType
PH 10 139 3.63e-2 SMART
C2 149 245 1.34e-7 SMART
RasGAP 255 592 1.08e-126 SMART
low complexity region 604 616 N/A INTRINSIC
Blast:RasGAP 629 694 4e-29 BLAST
low complexity region 733 745 N/A INTRINSIC
low complexity region 780 805 N/A INTRINSIC
low complexity region 855 873 N/A INTRINSIC
coiled coil region 961 1095 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091010
AA Change: I695K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088532
Gene: ENSMUSG00000026883
AA Change: I695K

DomainStartEndE-ValueType
low complexity region 13 39 N/A INTRINSIC
PH 73 204 5.58e-3 SMART
C2 214 310 1.34e-7 SMART
RasGAP 320 657 1.08e-126 SMART
low complexity region 669 681 N/A INTRINSIC
Blast:RasGAP 694 759 4e-29 BLAST
low complexity region 798 810 N/A INTRINSIC
low complexity region 845 870 N/A INTRINSIC
low complexity region 920 938 N/A INTRINSIC
coiled coil region 1026 1160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112981
SMART Domains Protein: ENSMUSP00000108605
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
Blast:PH 2 80 6e-35 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112983
AA Change: I571K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108607
Gene: ENSMUSG00000026883
AA Change: I571K

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
C2 90 186 1.34e-7 SMART
RasGAP 196 533 1.08e-126 SMART
low complexity region 545 557 N/A INTRINSIC
Blast:RasGAP 570 635 3e-29 BLAST
low complexity region 674 686 N/A INTRINSIC
low complexity region 721 746 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
coiled coil region 902 1036 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112986
AA Change: I667K

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108610
Gene: ENSMUSG00000026883
AA Change: I667K

DomainStartEndE-ValueType
PH 45 176 5.58e-3 SMART
C2 186 282 1.34e-7 SMART
RasGAP 292 629 1.08e-126 SMART
low complexity region 641 653 N/A INTRINSIC
Blast:RasGAP 666 731 4e-29 BLAST
low complexity region 770 782 N/A INTRINSIC
low complexity region 817 842 N/A INTRINSIC
low complexity region 892 910 N/A INTRINSIC
coiled coil region 998 1129 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112987
AA Change: I638K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108611
Gene: ENSMUSG00000026883
AA Change: I638K

DomainStartEndE-ValueType
PH 16 147 5.58e-3 SMART
C2 157 253 1.34e-7 SMART
RasGAP 263 600 1.08e-126 SMART
low complexity region 612 624 N/A INTRINSIC
Blast:RasGAP 637 702 4e-29 BLAST
low complexity region 741 753 N/A INTRINSIC
low complexity region 788 813 N/A INTRINSIC
low complexity region 863 881 N/A INTRINSIC
coiled coil region 969 1103 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112992
AA Change: I695K

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108616
Gene: ENSMUSG00000026883
AA Change: I695K

DomainStartEndE-ValueType
low complexity region 13 39 N/A INTRINSIC
PH 73 204 5.58e-3 SMART
C2 214 310 1.34e-7 SMART
RasGAP 320 657 1.08e-126 SMART
low complexity region 669 681 N/A INTRINSIC
Blast:RasGAP 694 759 4e-29 BLAST
low complexity region 798 810 N/A INTRINSIC
low complexity region 845 870 N/A INTRINSIC
low complexity region 920 938 N/A INTRINSIC
Pfam:DUF3498 986 1108 3.3e-61 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000119058
Gene: ENSMUSG00000026883
AA Change: I588K

DomainStartEndE-ValueType
low complexity region 24 36 N/A INTRINSIC
C2 108 204 1.34e-7 SMART
RasGAP 214 551 1.08e-126 SMART
low complexity region 563 575 N/A INTRINSIC
Blast:RasGAP 588 653 3e-29 BLAST
low complexity region 692 704 N/A INTRINSIC
low complexity region 739 764 N/A INTRINSIC
low complexity region 814 832 N/A INTRINSIC
coiled coil region 919 1053 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135741
AA Change: I638K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122341
Gene: ENSMUSG00000026883
AA Change: I638K

DomainStartEndE-ValueType
PH 16 147 5.58e-3 SMART
C2 157 253 1.34e-7 SMART
RasGAP 263 600 1.08e-126 SMART
low complexity region 612 624 N/A INTRINSIC
Blast:RasGAP 637 702 4e-29 BLAST
low complexity region 741 753 N/A INTRINSIC
low complexity region 788 813 N/A INTRINSIC
low complexity region 863 881 N/A INTRINSIC
coiled coil region 969 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145698
SMART Domains Protein: ENSMUSP00000114915
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
Blast:PH 1 79 3e-18 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 118 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156669
SMART Domains Protein: ENSMUSP00000121506
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
RasGAP 1 283 1.97e-88 SMART
low complexity region 295 307 N/A INTRINSIC
Pfam:DUF3498 317 594 2.9e-78 PFAM
Pfam:DUF3498 591 712 4.2e-70 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DAB2IP is a Ras (MIM 190020) GTPase-activating protein (GAP) that acts as a tumor suppressor. The DAB2IP gene is inactivated by methylation in prostate and breast cancers (Yano et al., 2005 [PubMed 15386433]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired IRE1-mediated endoplasmic reticulum (ER) stress-induced responses. Mice homozygous for a gene trap allele exhibit delayed Purkinje cell dendritogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Arl14ep T C 2: 106,969,217 D93G probably damaging Het
Bcl7b T C 5: 135,168,559 I18T probably damaging Het
Cdh1 A G 8: 106,663,869 I614V probably benign Het
Cpa3 T C 3: 20,227,236 I169V probably benign Het
Cpeb4 T C 11: 31,908,877 probably null Het
Csmd1 G A 8: 16,000,484 H2251Y possibly damaging Het
Dhtkd1 C A 2: 5,929,668 L230F possibly damaging Het
Emc1 T C 4: 139,361,289 S353P probably benign Het
Erc2 T A 14: 27,653,296 L157Q possibly damaging Het
Flvcr1 A G 1: 191,011,534 probably null Het
Fryl A C 5: 73,136,320 probably null Het
Gnl2 T C 4: 125,055,334 *729Q probably null Het
Gpr63 G A 4: 25,008,301 V342M possibly damaging Het
Guf1 C T 5: 69,566,467 P463L probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ifngr2 T C 16: 91,561,647 L245P probably damaging Het
Igsf10 A G 3: 59,329,143 F1206L probably damaging Het
Lekr1 A G 3: 65,684,099 K86E possibly damaging Het
Lrrc3 C T 10: 77,901,512 G30D possibly damaging Het
Mapk8ip2 T C 15: 89,460,694 F765L probably damaging Het
Myo6 A G 9: 80,276,350 T676A unknown Het
Nr4a1 T C 15: 101,273,172 S510P probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1218 T C 2: 89,055,302 I41M probably benign Het
Olfr1394 T C 11: 49,160,670 S219P probably damaging Het
Olfr558 C T 7: 102,710,195 T312I probably benign Het
Olfr76 A G 19: 12,120,421 L97P probably damaging Het
Pdcd1 G A 1: 94,041,468 L42F probably damaging Het
Pdzd7 T C 19: 45,030,051 D621G probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pias4 G A 10: 81,154,508 R398C probably benign Het
Prkag3 A G 1: 74,745,695 probably null Het
Ptpn7 A G 1: 135,133,868 T23A probably benign Het
Ptprd T C 4: 75,955,289 D1069G probably damaging Het
Ptprr A G 10: 116,251,125 Y503C probably damaging Het
Slc26a8 T C 17: 28,647,925 D610G probably benign Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Tenm3 A G 8: 48,287,848 F1200S probably damaging Het
Tox3 A G 8: 90,257,967 S195P probably benign Het
Trim44 T C 2: 102,400,173 E171G probably damaging Het
Vars T A 17: 35,010,514 M369K probably damaging Het
Vmn2r77 C A 7: 86,801,739 Q278K probably benign Het
Zfp345 T C 2: 150,472,820 T266A probably damaging Het
Other mutations in Dab2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Dab2ip APN 2 35720013 missense probably damaging 1.00
IGL00799:Dab2ip APN 2 35707775 missense probably benign 0.25
IGL00902:Dab2ip APN 2 35717112 missense probably damaging 1.00
IGL00929:Dab2ip APN 2 35708877 missense possibly damaging 0.91
IGL03052:Dab2ip UTSW 2 35643897 missense probably benign 0.27
R0097:Dab2ip UTSW 2 35718916 missense possibly damaging 0.95
R0137:Dab2ip UTSW 2 35692376 critical splice donor site probably null
R0184:Dab2ip UTSW 2 35718791 missense probably damaging 1.00
R1195:Dab2ip UTSW 2 35718745 splice site probably benign
R1195:Dab2ip UTSW 2 35718745 splice site probably benign
R1388:Dab2ip UTSW 2 35721256 intron probably benign
R1442:Dab2ip UTSW 2 35710256 missense probably damaging 0.97
R1496:Dab2ip UTSW 2 35718791 missense probably damaging 1.00
R1665:Dab2ip UTSW 2 35720278 missense probably damaging 1.00
R1909:Dab2ip UTSW 2 35718815 missense probably damaging 1.00
R3625:Dab2ip UTSW 2 35643891 nonsense probably null
R3819:Dab2ip UTSW 2 35713210 missense probably damaging 1.00
R4333:Dab2ip UTSW 2 35661620 makesense probably null
R4869:Dab2ip UTSW 2 35720037 missense probably damaging 1.00
R4894:Dab2ip UTSW 2 35730527 utr 3 prime probably benign
R5035:Dab2ip UTSW 2 35709941 missense probably benign 0.03
R5180:Dab2ip UTSW 2 35720491 missense possibly damaging 0.83
R5425:Dab2ip UTSW 2 35709991 missense probably benign 0.25
R5513:Dab2ip UTSW 2 35710254 missense probably benign 0.11
R5579:Dab2ip UTSW 2 35715327 nonsense probably null
R5829:Dab2ip UTSW 2 35707775 unclassified probably benign
R5840:Dab2ip UTSW 2 35727499 missense probably damaging 0.98
R5890:Dab2ip UTSW 2 35715402 missense probably damaging 1.00
R6057:Dab2ip UTSW 2 35692255 nonsense probably null
R6235:Dab2ip UTSW 2 35723087 missense probably damaging 1.00
R6360:Dab2ip UTSW 2 35710266 missense probably benign 0.38
R6571:Dab2ip UTSW 2 35712890 missense probably damaging 1.00
R6813:Dab2ip UTSW 2 35730473 nonsense probably null
R7262:Dab2ip UTSW 2 35622286 splice site probably null
R7883:Dab2ip UTSW 2 35720206 missense possibly damaging 0.51
R8127:Dab2ip UTSW 2 35644126 critical splice donor site probably benign
R8313:Dab2ip UTSW 2 35727428 missense probably damaging 1.00
R8422:Dab2ip UTSW 2 35707755 missense probably damaging 0.97
X0011:Dab2ip UTSW 2 35723085 nonsense probably null
Z1176:Dab2ip UTSW 2 35708868 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGGACCAGCTACCTCAC -3'
(R):5'- TGGTACACAGGATTCTGGAAG -3'

Sequencing Primer
(F):5'- AGCTACCTCACCAGTGATCCTG -3'
(R):5'- ACTGTGGCCAATCCTGC -3'
Posted On2020-09-02