Incidental Mutation 'R8387:Vmn2r77'
ID647205
Institutional Source Beutler Lab
Gene Symbol Vmn2r77
Ensembl Gene ENSMUSG00000090949
Gene Namevomeronasal 2, receptor 77
SynonymsEG546983
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R8387 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86795141-86812032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 86801739 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 278 (Q278K)
Ref Sequence ENSEMBL: ENSMUSP00000129540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164996]
Predicted Effect probably benign
Transcript: ENSMUST00000164996
AA Change: Q278K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129540
Gene: ENSMUSG00000090949
AA Change: Q278K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 467 1.4e-30 PFAM
Pfam:NCD3G 510 562 1e-20 PFAM
Pfam:7tm_3 594 830 2.6e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Arl14ep T C 2: 106,969,217 D93G probably damaging Het
Bcl7b T C 5: 135,168,559 I18T probably damaging Het
Cdh1 A G 8: 106,663,869 I614V probably benign Het
Cpa3 T C 3: 20,227,236 I169V probably benign Het
Cpeb4 T C 11: 31,908,877 probably null Het
Csmd1 G A 8: 16,000,484 H2251Y possibly damaging Het
Dab2ip T A 2: 35,719,858 I695K probably damaging Het
Dhtkd1 C A 2: 5,929,668 L230F possibly damaging Het
Emc1 T C 4: 139,361,289 S353P probably benign Het
Erc2 T A 14: 27,653,296 L157Q possibly damaging Het
Flvcr1 A G 1: 191,011,534 probably null Het
Fryl A C 5: 73,136,320 probably null Het
Gnl2 T C 4: 125,055,334 *729Q probably null Het
Gpr63 G A 4: 25,008,301 V342M possibly damaging Het
Guf1 C T 5: 69,566,467 P463L probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ifngr2 T C 16: 91,561,647 L245P probably damaging Het
Igsf10 A G 3: 59,329,143 F1206L probably damaging Het
Lekr1 A G 3: 65,684,099 K86E possibly damaging Het
Lrrc3 C T 10: 77,901,512 G30D possibly damaging Het
Mapk8ip2 T C 15: 89,460,694 F765L probably damaging Het
Myo6 A G 9: 80,276,350 T676A unknown Het
Nr4a1 T C 15: 101,273,172 S510P probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1218 T C 2: 89,055,302 I41M probably benign Het
Olfr1394 T C 11: 49,160,670 S219P probably damaging Het
Olfr558 C T 7: 102,710,195 T312I probably benign Het
Olfr76 A G 19: 12,120,421 L97P probably damaging Het
Pdcd1 G A 1: 94,041,468 L42F probably damaging Het
Pdzd7 T C 19: 45,030,051 D621G probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pias4 G A 10: 81,154,508 R398C probably benign Het
Prkag3 A G 1: 74,745,695 probably null Het
Ptpn7 A G 1: 135,133,868 T23A probably benign Het
Ptprd T C 4: 75,955,289 D1069G probably damaging Het
Ptprr A G 10: 116,251,125 Y503C probably damaging Het
Slc26a8 T C 17: 28,647,925 D610G probably benign Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Tenm3 A G 8: 48,287,848 F1200S probably damaging Het
Tox3 A G 8: 90,257,967 S195P probably benign Het
Trim44 T C 2: 102,400,173 E171G probably damaging Het
Vars T A 17: 35,010,514 M369K probably damaging Het
Zfp345 T C 2: 150,472,820 T266A probably damaging Het
Other mutations in Vmn2r77
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Vmn2r77 APN 7 86800767 missense probably benign 0.06
IGL01105:Vmn2r77 APN 7 86811664 missense probably damaging 0.99
IGL01367:Vmn2r77 APN 7 86811916 missense probably damaging 0.98
IGL01634:Vmn2r77 APN 7 86811649 missense probably benign
IGL01805:Vmn2r77 APN 7 86811187 missense probably benign 0.18
IGL01868:Vmn2r77 APN 7 86803016 missense probably benign 0.00
IGL01980:Vmn2r77 APN 7 86801470 missense probably benign 0.14
IGL02055:Vmn2r77 APN 7 86801555 missense probably benign 0.00
IGL02066:Vmn2r77 APN 7 86803628 nonsense probably null
IGL02185:Vmn2r77 APN 7 86795152 missense unknown
IGL02200:Vmn2r77 APN 7 86801979 missense probably benign 0.04
IGL02336:Vmn2r77 APN 7 86802016 missense probably damaging 0.99
IGL02445:Vmn2r77 APN 7 86803640 nonsense probably null
IGL02557:Vmn2r77 APN 7 86795134 unclassified probably benign
IGL02659:Vmn2r77 APN 7 86800771 missense probably benign 0.32
IGL02978:Vmn2r77 APN 7 86811347 missense probably benign
IGL03180:Vmn2r77 APN 7 86801635 missense possibly damaging 0.85
IGL03255:Vmn2r77 APN 7 86811923 missense probably benign 0.04
IGL03273:Vmn2r77 APN 7 86811286 missense probably damaging 0.99
R0046:Vmn2r77 UTSW 7 86801938 missense possibly damaging 0.73
R0047:Vmn2r77 UTSW 7 86811650 missense probably benign 0.01
R0066:Vmn2r77 UTSW 7 86800756 missense probably benign 0.17
R0066:Vmn2r77 UTSW 7 86800756 missense probably benign 0.17
R0389:Vmn2r77 UTSW 7 86801494 missense probably benign 0.29
R0635:Vmn2r77 UTSW 7 86811175 missense probably benign
R0689:Vmn2r77 UTSW 7 86811664 missense probably damaging 0.99
R0827:Vmn2r77 UTSW 7 86802016 missense probably damaging 1.00
R1167:Vmn2r77 UTSW 7 86801746 missense probably benign 0.02
R1228:Vmn2r77 UTSW 7 86801034 critical splice donor site probably null
R1353:Vmn2r77 UTSW 7 86802186 missense probably benign 0.29
R1392:Vmn2r77 UTSW 7 86801622 missense probably benign 0.00
R1392:Vmn2r77 UTSW 7 86801622 missense probably benign 0.00
R1613:Vmn2r77 UTSW 7 86811148 missense probably damaging 1.00
R1654:Vmn2r77 UTSW 7 86811915 missense probably damaging 1.00
R1742:Vmn2r77 UTSW 7 86795335 missense probably benign 0.35
R1827:Vmn2r77 UTSW 7 86801613 missense probably damaging 0.99
R1911:Vmn2r77 UTSW 7 86811793 missense probably damaging 1.00
R1974:Vmn2r77 UTSW 7 86800756 missense probably benign 0.17
R2008:Vmn2r77 UTSW 7 86801713 missense probably benign 0.31
R2093:Vmn2r77 UTSW 7 86801494 missense probably benign 0.29
R2143:Vmn2r77 UTSW 7 86811944 missense probably damaging 1.00
R2269:Vmn2r77 UTSW 7 86811689 missense probably benign 0.03
R2972:Vmn2r77 UTSW 7 86803685 missense probably benign 0.01
R2974:Vmn2r77 UTSW 7 86803685 missense probably benign 0.01
R3037:Vmn2r77 UTSW 7 86800983 missense probably benign
R3694:Vmn2r77 UTSW 7 86800836 missense probably damaging 1.00
R3695:Vmn2r77 UTSW 7 86800836 missense probably damaging 1.00
R3805:Vmn2r77 UTSW 7 86795160 nonsense probably null
R3870:Vmn2r77 UTSW 7 86811842 missense probably damaging 1.00
R4732:Vmn2r77 UTSW 7 86800987 missense probably benign 0.00
R4733:Vmn2r77 UTSW 7 86800987 missense probably benign 0.00
R5009:Vmn2r77 UTSW 7 86801807 missense possibly damaging 0.82
R5201:Vmn2r77 UTSW 7 86811638 missense probably damaging 0.98
R5218:Vmn2r77 UTSW 7 86802133 missense probably damaging 0.98
R5469:Vmn2r77 UTSW 7 86802063 missense probably benign 0.01
R5673:Vmn2r77 UTSW 7 86812006 missense probably benign 0.05
R5771:Vmn2r77 UTSW 7 86812027 missense probably benign 0.06
R5832:Vmn2r77 UTSW 7 86811462 nonsense probably null
R5899:Vmn2r77 UTSW 7 86811716 missense probably damaging 1.00
R6151:Vmn2r77 UTSW 7 86801670 missense probably benign 0.00
R6182:Vmn2r77 UTSW 7 86811749 missense probably damaging 1.00
R6326:Vmn2r77 UTSW 7 86801823 missense probably benign
R6419:Vmn2r77 UTSW 7 86811559 missense probably damaging 0.99
R6549:Vmn2r77 UTSW 7 86800857 missense probably benign 0.06
R6874:Vmn2r77 UTSW 7 86802078 missense probably benign 0.00
R6972:Vmn2r77 UTSW 7 86802994 missense probably damaging 1.00
R7056:Vmn2r77 UTSW 7 86801815 missense probably benign 0.06
R7185:Vmn2r77 UTSW 7 86801827 missense probably benign 0.00
R7261:Vmn2r77 UTSW 7 86811310 nonsense probably null
R7298:Vmn2r77 UTSW 7 86800771 missense probably benign 0.00
R7662:Vmn2r77 UTSW 7 86811284 nonsense probably null
R8182:Vmn2r77 UTSW 7 86811593 missense probably damaging 1.00
R8327:Vmn2r77 UTSW 7 86801472 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACTTCAGATGGAACTGGGTAGG -3'
(R):5'- TGTAGTTAGAAGGGTTCACTCTCTG -3'

Sequencing Primer
(F):5'- CTGGGTAGGAGTCATCATTACAG -3'
(R):5'- GAAGGGTTCACTCTCTGAATAAAGTG -3'
Posted On2020-09-02