Incidental Mutation 'R8387:Plekha6'
ID660649
Institutional Source Beutler Lab
Gene Symbol Plekha6
Ensembl Gene ENSMUSG00000041757
Gene Namepleckstrin homology domain containing, family A member 6
SynonymsPepp3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R8387 (G1)
Quality Score96.0077
Status Validated
Chromosome1
Chromosomal Location133164210-133303435 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 133292155 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038295] [ENSMUST00000105082] [ENSMUST00000186917] [ENSMUST00000187285]
Predicted Effect probably benign
Transcript: ENSMUST00000038295
SMART Domains Protein: ENSMUSP00000048214
Gene: ENSMUSG00000041757

DomainStartEndE-ValueType
PH 60 160 2.23e-20 SMART
low complexity region 217 231 N/A INTRINSIC
low complexity region 353 367 N/A INTRINSIC
Blast:PH 506 576 6e-31 BLAST
coiled coil region 613 686 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
low complexity region 812 827 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105082
SMART Domains Protein: ENSMUSP00000100703
Gene: ENSMUSG00000041757

DomainStartEndE-ValueType
PH 60 180 1.24e-18 SMART
low complexity region 237 251 N/A INTRINSIC
low complexity region 373 387 N/A INTRINSIC
coiled coil region 559 632 N/A INTRINSIC
low complexity region 707 728 N/A INTRINSIC
low complexity region 1035 1049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186917
SMART Domains Protein: ENSMUSP00000139794
Gene: ENSMUSG00000041757

DomainStartEndE-ValueType
PH 60 180 1.24e-18 SMART
low complexity region 237 251 N/A INTRINSIC
low complexity region 373 387 N/A INTRINSIC
coiled coil region 559 632 N/A INTRINSIC
low complexity region 707 728 N/A INTRINSIC
low complexity region 1035 1049 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187285
SMART Domains Protein: ENSMUSP00000140558
Gene: ENSMUSG00000041757

DomainStartEndE-ValueType
PH 60 160 9.6e-23 SMART
low complexity region 217 231 N/A INTRINSIC
low complexity region 353 367 N/A INTRINSIC
coiled coil region 539 612 N/A INTRINSIC
low complexity region 687 708 N/A INTRINSIC
low complexity region 1014 1028 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190186
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Arl14ep T C 2: 106,969,217 D93G probably damaging Het
Bcl7b T C 5: 135,168,559 I18T probably damaging Het
Cdh1 A G 8: 106,663,869 I614V probably benign Het
Cpa3 T C 3: 20,227,236 I169V probably benign Het
Cpeb4 T C 11: 31,908,877 probably null Het
Csmd1 G A 8: 16,000,484 H2251Y possibly damaging Het
Dab2ip T A 2: 35,719,858 I695K probably damaging Het
Dhtkd1 C A 2: 5,929,668 L230F possibly damaging Het
Emc1 T C 4: 139,361,289 S353P probably benign Het
Erc2 T A 14: 27,653,296 L157Q possibly damaging Het
Flvcr1 A G 1: 191,011,534 probably null Het
Fryl A C 5: 73,136,320 probably null Het
Gnl2 T C 4: 125,055,334 *729Q probably null Het
Gpr63 G A 4: 25,008,301 V342M possibly damaging Het
Guf1 C T 5: 69,566,467 P463L probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ifngr2 T C 16: 91,561,647 L245P probably damaging Het
Igsf10 A G 3: 59,329,143 F1206L probably damaging Het
Ktn1 T A 14: 47,707,287 probably null Het
Lekr1 A G 3: 65,684,099 K86E possibly damaging Het
Lrrc3 C T 10: 77,901,512 G30D possibly damaging Het
Mapk8ip2 T C 15: 89,460,694 F765L probably damaging Het
Myo6 A G 9: 80,276,350 T676A unknown Het
Nr4a1 T C 15: 101,273,172 S510P probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1218 T C 2: 89,055,302 I41M probably benign Het
Olfr1394 T C 11: 49,160,670 S219P probably damaging Het
Olfr558 C T 7: 102,710,195 T312I probably benign Het
Olfr76 A G 19: 12,120,421 L97P probably damaging Het
Pdcd1 G A 1: 94,041,468 L42F probably damaging Het
Pdzd7 T C 19: 45,030,051 D621G probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pias4 G A 10: 81,154,508 R398C probably benign Het
Prkag3 A G 1: 74,745,695 probably null Het
Ptpn7 A G 1: 135,133,868 T23A probably benign Het
Ptprd T C 4: 75,955,289 D1069G probably damaging Het
Ptprr A G 10: 116,251,125 Y503C probably damaging Het
Slc26a8 T C 17: 28,647,925 D610G probably benign Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Tenm3 A G 8: 48,287,848 F1200S probably damaging Het
Tox3 A G 8: 90,257,967 S195P probably benign Het
Trim44 T C 2: 102,400,173 E171G probably damaging Het
Vars T A 17: 35,010,514 M369K probably damaging Het
Vmn2r77 C A 7: 86,801,739 Q278K probably benign Het
Zfp345 T C 2: 150,472,820 T266A probably damaging Het
Other mutations in Plekha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Plekha6 APN 1 133282165 missense possibly damaging 0.92
IGL01328:Plekha6 APN 1 133272336 splice site probably null
IGL01739:Plekha6 APN 1 133260131 missense probably benign 0.38
IGL01803:Plekha6 APN 1 133272414 nonsense probably null
IGL02053:Plekha6 APN 1 133272492 missense probably damaging 1.00
IGL02269:Plekha6 APN 1 133287849 missense possibly damaging 0.82
IGL02276:Plekha6 APN 1 133293861 missense possibly damaging 0.93
IGL02478:Plekha6 APN 1 133283293 missense probably benign 0.03
IGL02754:Plekha6 APN 1 133284938 missense probably damaging 0.98
G1Funyon:Plekha6 UTSW 1 133264687 missense probably damaging 0.96
R0100:Plekha6 UTSW 1 133270177 missense probably damaging 0.99
R0334:Plekha6 UTSW 1 133282180 missense probably benign 0.24
R0470:Plekha6 UTSW 1 133272307 missense probably benign 0.07
R1016:Plekha6 UTSW 1 133260094 missense probably benign 0.00
R1254:Plekha6 UTSW 1 133272589 missense probably benign 0.10
R1728:Plekha6 UTSW 1 133287846 missense probably benign
R1729:Plekha6 UTSW 1 133287846 missense probably benign
R1730:Plekha6 UTSW 1 133287846 missense probably benign
R1739:Plekha6 UTSW 1 133287846 missense probably benign
R1762:Plekha6 UTSW 1 133287846 missense probably benign
R1771:Plekha6 UTSW 1 133273913 missense probably benign 0.00
R1783:Plekha6 UTSW 1 133287846 missense probably benign
R1784:Plekha6 UTSW 1 133287846 missense probably benign
R1785:Plekha6 UTSW 1 133287846 missense probably benign
R1786:Plekha6 UTSW 1 133279365 splice site probably null
R1997:Plekha6 UTSW 1 133263818 missense probably benign 0.43
R2020:Plekha6 UTSW 1 133284970 missense possibly damaging 0.55
R2130:Plekha6 UTSW 1 133279365 splice site probably null
R2131:Plekha6 UTSW 1 133279365 splice site probably null
R2133:Plekha6 UTSW 1 133279365 splice site probably null
R2992:Plekha6 UTSW 1 133294658 missense probably damaging 1.00
R3781:Plekha6 UTSW 1 133294655 missense probably damaging 1.00
R3810:Plekha6 UTSW 1 133273979 missense probably benign
R4067:Plekha6 UTSW 1 133294678 missense probably benign 0.40
R4725:Plekha6 UTSW 1 133283320 missense probably damaging 1.00
R5657:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5658:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5746:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5768:Plekha6 UTSW 1 133280378 missense probably benign 0.01
R5785:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5892:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5937:Plekha6 UTSW 1 133260101 missense possibly damaging 0.89
R5985:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5986:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R6053:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R6072:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R6167:Plekha6 UTSW 1 133279407 missense probably null 0.96
R6843:Plekha6 UTSW 1 133274878 missense probably damaging 1.00
R6879:Plekha6 UTSW 1 133260055 missense possibly damaging 0.95
R6912:Plekha6 UTSW 1 133272535 missense probably benign 0.02
R6970:Plekha6 UTSW 1 133263818 missense probably benign 0.43
R7041:Plekha6 UTSW 1 133272460 missense possibly damaging 0.93
R7248:Plekha6 UTSW 1 133275848 nonsense probably null
R7400:Plekha6 UTSW 1 133274024 nonsense probably null
R7720:Plekha6 UTSW 1 133293707 missense probably damaging 1.00
R7772:Plekha6 UTSW 1 133170022 missense possibly damaging 0.57
R8011:Plekha6 UTSW 1 133263806 missense probably benign
R8301:Plekha6 UTSW 1 133264687 missense probably damaging 0.96
R8465:Plekha6 UTSW 1 133270040 missense probably damaging 0.98
R8501:Plekha6 UTSW 1 133287837 missense probably benign 0.34
R9025:Plekha6 UTSW 1 133285261 missense probably benign 0.01
R9044:Plekha6 UTSW 1 133273949 missense probably benign 0.01
R9044:Plekha6 UTSW 1 133273950 missense possibly damaging 0.95
Z1176:Plekha6 UTSW 1 133263813 missense probably benign 0.00
Z1176:Plekha6 UTSW 1 133272471 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTTCTTCACGTATATGGAGTCC -3'
(R):5'- TGGAGAAACAAGGCTCTGC -3'

Sequencing Primer
(F):5'- AGTCCCAGTGAAGGTGCTG -3'
(R):5'- TCTGCCAGGTAGGTGCTCAC -3'
Posted On2021-01-22