Incidental Mutation 'R4894:Dab2ip'
ID 377465
Institutional Source Beutler Lab
Gene Symbol Dab2ip
Ensembl Gene ENSMUSG00000026883
Gene Name disabled 2 interacting protein
Synonyms 2310011D08Rik, AIP1
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.321) question?
Stock # R4894 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 35448285-35621006 bp(+) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) A to G at 35620539 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000065001] [ENSMUST00000091010] [ENSMUST00000112983] [ENSMUST00000112986] [ENSMUST00000112987] [ENSMUST00000135741] [ENSMUST00000145698] [ENSMUST00000112992]
AlphaFold Q3UHC7
Predicted Effect probably benign
Transcript: ENSMUST00000065001
SMART Domains Protein: ENSMUSP00000068832
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
PH 10 139 3.63e-2 SMART
C2 149 245 1.34e-7 SMART
RasGAP 255 592 1.08e-126 SMART
low complexity region 604 616 N/A INTRINSIC
Blast:RasGAP 629 694 4e-29 BLAST
low complexity region 733 745 N/A INTRINSIC
low complexity region 780 805 N/A INTRINSIC
low complexity region 855 873 N/A INTRINSIC
coiled coil region 961 1095 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091010
SMART Domains Protein: ENSMUSP00000088532
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
low complexity region 13 39 N/A INTRINSIC
PH 73 204 5.58e-3 SMART
C2 214 310 1.34e-7 SMART
RasGAP 320 657 1.08e-126 SMART
low complexity region 669 681 N/A INTRINSIC
Blast:RasGAP 694 759 4e-29 BLAST
low complexity region 798 810 N/A INTRINSIC
low complexity region 845 870 N/A INTRINSIC
low complexity region 920 938 N/A INTRINSIC
coiled coil region 1026 1160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112981
SMART Domains Protein: ENSMUSP00000108605
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
Blast:PH 2 80 6e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112983
SMART Domains Protein: ENSMUSP00000108607
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
C2 90 186 1.34e-7 SMART
RasGAP 196 533 1.08e-126 SMART
low complexity region 545 557 N/A INTRINSIC
Blast:RasGAP 570 635 3e-29 BLAST
low complexity region 674 686 N/A INTRINSIC
low complexity region 721 746 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
coiled coil region 902 1036 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112986
SMART Domains Protein: ENSMUSP00000108610
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
PH 45 176 5.58e-3 SMART
C2 186 282 1.34e-7 SMART
RasGAP 292 629 1.08e-126 SMART
low complexity region 641 653 N/A INTRINSIC
Blast:RasGAP 666 731 4e-29 BLAST
low complexity region 770 782 N/A INTRINSIC
low complexity region 817 842 N/A INTRINSIC
low complexity region 892 910 N/A INTRINSIC
coiled coil region 998 1129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112987
SMART Domains Protein: ENSMUSP00000108611
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
PH 16 147 5.58e-3 SMART
C2 157 253 1.34e-7 SMART
RasGAP 263 600 1.08e-126 SMART
low complexity region 612 624 N/A INTRINSIC
Blast:RasGAP 637 702 4e-29 BLAST
low complexity region 741 753 N/A INTRINSIC
low complexity region 788 813 N/A INTRINSIC
low complexity region 863 881 N/A INTRINSIC
coiled coil region 969 1103 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000135741
AA Change: R1136G
SMART Domains Protein: ENSMUSP00000122341
Gene: ENSMUSG00000026883
AA Change: R1136G

DomainStartEndE-ValueType
PH 16 147 5.58e-3 SMART
C2 157 253 1.34e-7 SMART
RasGAP 263 600 1.08e-126 SMART
low complexity region 612 624 N/A INTRINSIC
Blast:RasGAP 637 702 4e-29 BLAST
low complexity region 741 753 N/A INTRINSIC
low complexity region 788 813 N/A INTRINSIC
low complexity region 863 881 N/A INTRINSIC
coiled coil region 969 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145698
SMART Domains Protein: ENSMUSP00000114915
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
Blast:PH 1 79 3e-18 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 118 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156669
SMART Domains Protein: ENSMUSP00000121506
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
RasGAP 1 283 1.97e-88 SMART
low complexity region 295 307 N/A INTRINSIC
Pfam:DUF3498 317 594 2.9e-78 PFAM
Pfam:DUF3498 591 712 4.2e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112992
SMART Domains Protein: ENSMUSP00000108616
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
low complexity region 13 39 N/A INTRINSIC
PH 73 204 5.58e-3 SMART
C2 214 310 1.34e-7 SMART
RasGAP 320 657 1.08e-126 SMART
low complexity region 669 681 N/A INTRINSIC
Blast:RasGAP 694 759 4e-29 BLAST
low complexity region 798 810 N/A INTRINSIC
low complexity region 845 870 N/A INTRINSIC
low complexity region 920 938 N/A INTRINSIC
Pfam:DUF3498 986 1108 3.3e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124098
SMART Domains Protein: ENSMUSP00000119058
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
low complexity region 24 36 N/A INTRINSIC
C2 108 204 1.34e-7 SMART
RasGAP 214 551 1.08e-126 SMART
low complexity region 563 575 N/A INTRINSIC
Blast:RasGAP 588 653 3e-29 BLAST
low complexity region 692 704 N/A INTRINSIC
low complexity region 739 764 N/A INTRINSIC
low complexity region 814 832 N/A INTRINSIC
coiled coil region 919 1053 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DAB2IP is a Ras (MIM 190020) GTPase-activating protein (GAP) that acts as a tumor suppressor. The DAB2IP gene is inactivated by methylation in prostate and breast cancers (Yano et al., 2005 [PubMed 15386433]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired IRE1-mediated endoplasmic reticulum (ER) stress-induced responses. Mice homozygous for a gene trap allele exhibit delayed Purkinje cell dendritogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,609,975 (GRCm39) Y176* probably null Het
Akap13 T A 7: 75,375,068 (GRCm39) M1900K possibly damaging Het
Ankrd36 A G 11: 5,585,332 (GRCm39) E381G probably damaging Het
Ap3s1 T C 18: 46,891,183 (GRCm39) probably null Het
Cacna1e G T 1: 154,364,551 (GRCm39) S341* probably null Het
Camk1d G A 2: 5,359,539 (GRCm39) S161L probably damaging Het
Cdh23 G T 10: 60,173,630 (GRCm39) H1619Q probably benign Het
Chd7 T A 4: 8,838,629 (GRCm39) I1276N probably damaging Het
Clca3a1 A G 3: 144,719,662 (GRCm39) V436A probably damaging Het
Ctcfl G A 2: 172,959,196 (GRCm39) P177S probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Epc1 A T 18: 6,449,011 (GRCm39) S495R probably benign Het
Espl1 A G 15: 102,230,758 (GRCm39) probably null Het
Eya4 T C 10: 22,985,753 (GRCm39) E583G possibly damaging Het
Fam111a C G 19: 12,565,913 (GRCm39) T554R probably benign Het
Fbh1 A T 2: 11,767,771 (GRCm39) I359N probably damaging Het
Fer1l6 T C 15: 58,490,751 (GRCm39) C1023R probably damaging Het
Helz2 G C 2: 180,877,940 (GRCm39) P953A probably benign Het
Ifi204 G T 1: 173,587,808 (GRCm39) S117Y probably damaging Het
Ift70a1 T C 2: 75,810,088 (GRCm39) *665W probably null Het
Igfn1 G A 1: 135,882,520 (GRCm39) T2775M probably damaging Het
Igsf9 A G 1: 172,325,634 (GRCm39) T1101A probably benign Het
Ipo13 A C 4: 117,760,638 (GRCm39) I614S probably damaging Het
Ipo13 A G 4: 117,761,687 (GRCm39) I476T possibly damaging Het
Kdm2b C A 5: 123,079,030 (GRCm39) E308* probably null Het
Klhl20 A T 1: 160,937,102 (GRCm39) M91K possibly damaging Het
Klrb1f T C 6: 129,030,151 (GRCm39) F64L probably benign Het
Ldlrad3 C T 2: 101,888,293 (GRCm39) C106Y probably damaging Het
Lilra6 T C 7: 3,915,530 (GRCm39) T161A probably benign Het
Lrriq1 A T 10: 102,997,613 (GRCm39) M1334K possibly damaging Het
Mepe C G 5: 104,473,268 (GRCm39) P3R probably damaging Het
Mgat4e A G 1: 134,468,856 (GRCm39) V396A probably benign Het
Nfx1 T G 4: 40,996,877 (GRCm39) S651A probably damaging Het
Or10ak13 A T 4: 118,639,483 (GRCm39) C100S probably damaging Het
Or2w6 T C 13: 21,843,352 (GRCm39) N47S probably damaging Het
Or4c109 T C 2: 88,817,783 (GRCm39) I254M possibly damaging Het
Rag2 T C 2: 101,460,022 (GRCm39) S111P probably damaging Het
Rai1 T A 11: 60,077,572 (GRCm39) D545E probably damaging Het
Ralgps1 A G 2: 33,033,115 (GRCm39) V498A possibly damaging Het
Rasal2 G A 1: 157,020,374 (GRCm39) S205L probably damaging Het
Rec8 T C 14: 55,862,787 (GRCm39) L582P probably damaging Het
Retn G A 8: 3,707,358 (GRCm39) R106H probably damaging Het
Rnf112 A G 11: 61,343,488 (GRCm39) L116P probably damaging Het
Rnf213 T C 11: 119,372,066 (GRCm39) Y4885H probably damaging Het
Sacm1l A G 9: 123,411,409 (GRCm39) I399M probably benign Het
Sez6 G T 11: 77,866,086 (GRCm39) G738V probably damaging Het
Spata17 A G 1: 186,872,643 (GRCm39) V56A probably benign Het
Spata31d1a A T 13: 59,849,542 (GRCm39) V862D probably damaging Het
Sptb A G 12: 76,671,768 (GRCm39) probably null Het
Srpk2 C A 5: 23,750,527 (GRCm39) G59W probably damaging Het
Tyro3 T C 2: 119,632,779 (GRCm39) S96P probably damaging Het
Ube2v1 A G 2: 167,452,280 (GRCm39) S108P probably damaging Het
Usp2 C T 9: 43,987,125 (GRCm39) S141L probably benign Het
Vamp5 T C 6: 72,347,181 (GRCm39) D46G possibly damaging Het
Vmn1r23 T A 6: 57,903,310 (GRCm39) Q156L probably benign Het
Vmn2r6 C T 3: 64,454,829 (GRCm39) S490N probably benign Het
Vps39 A T 2: 120,183,440 (GRCm39) I10N probably damaging Het
Vwf C T 6: 125,622,897 (GRCm39) Q1755* probably null Het
Wdfy4 A T 14: 32,877,717 (GRCm39) H82Q probably benign Het
Wdr24 T C 17: 26,045,101 (GRCm39) Y279H probably damaging Het
Wdr72 A G 9: 74,117,843 (GRCm39) T852A probably benign Het
Zfp1 T A 8: 112,396,355 (GRCm39) C92* probably null Het
Zfp1004 T A 2: 150,033,899 (GRCm39) C104* probably null Het
Zfp426 A T 9: 20,386,369 (GRCm39) probably benign Het
Zfp442 C T 2: 150,253,130 (GRCm39) probably null Het
Zfp74 T C 7: 29,635,470 (GRCm39) probably benign Het
Other mutations in Dab2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Dab2ip APN 2 35,610,025 (GRCm39) missense probably damaging 1.00
IGL00799:Dab2ip APN 2 35,597,787 (GRCm39) missense probably benign 0.25
IGL00902:Dab2ip APN 2 35,607,124 (GRCm39) missense probably damaging 1.00
IGL00929:Dab2ip APN 2 35,598,889 (GRCm39) missense possibly damaging 0.91
IGL03052:Dab2ip UTSW 2 35,533,909 (GRCm39) missense probably benign 0.27
R0097:Dab2ip UTSW 2 35,608,928 (GRCm39) missense possibly damaging 0.95
R0137:Dab2ip UTSW 2 35,582,388 (GRCm39) critical splice donor site probably null
R0184:Dab2ip UTSW 2 35,608,803 (GRCm39) missense probably damaging 1.00
R1195:Dab2ip UTSW 2 35,608,757 (GRCm39) splice site probably benign
R1195:Dab2ip UTSW 2 35,608,757 (GRCm39) splice site probably benign
R1388:Dab2ip UTSW 2 35,611,268 (GRCm39) intron probably benign
R1442:Dab2ip UTSW 2 35,600,268 (GRCm39) missense probably damaging 0.97
R1496:Dab2ip UTSW 2 35,608,803 (GRCm39) missense probably damaging 1.00
R1665:Dab2ip UTSW 2 35,610,290 (GRCm39) missense probably damaging 1.00
R1909:Dab2ip UTSW 2 35,608,827 (GRCm39) missense probably damaging 1.00
R3625:Dab2ip UTSW 2 35,533,903 (GRCm39) nonsense probably null
R3819:Dab2ip UTSW 2 35,603,222 (GRCm39) missense probably damaging 1.00
R4333:Dab2ip UTSW 2 35,551,632 (GRCm39) makesense probably null
R4869:Dab2ip UTSW 2 35,610,049 (GRCm39) missense probably damaging 1.00
R5035:Dab2ip UTSW 2 35,599,953 (GRCm39) missense probably benign 0.03
R5180:Dab2ip UTSW 2 35,610,503 (GRCm39) missense possibly damaging 0.83
R5425:Dab2ip UTSW 2 35,600,003 (GRCm39) missense probably benign 0.25
R5513:Dab2ip UTSW 2 35,600,266 (GRCm39) missense probably benign 0.11
R5579:Dab2ip UTSW 2 35,605,339 (GRCm39) nonsense probably null
R5829:Dab2ip UTSW 2 35,597,787 (GRCm39) unclassified probably benign
R5840:Dab2ip UTSW 2 35,617,511 (GRCm39) missense probably damaging 0.98
R5890:Dab2ip UTSW 2 35,605,414 (GRCm39) missense probably damaging 1.00
R6057:Dab2ip UTSW 2 35,582,267 (GRCm39) nonsense probably null
R6235:Dab2ip UTSW 2 35,613,099 (GRCm39) missense probably damaging 1.00
R6360:Dab2ip UTSW 2 35,600,278 (GRCm39) missense probably benign 0.38
R6571:Dab2ip UTSW 2 35,602,902 (GRCm39) missense probably damaging 1.00
R6813:Dab2ip UTSW 2 35,620,485 (GRCm39) nonsense probably null
R7262:Dab2ip UTSW 2 35,512,298 (GRCm39) splice site probably null
R7883:Dab2ip UTSW 2 35,610,218 (GRCm39) missense possibly damaging 0.51
R8127:Dab2ip UTSW 2 35,534,138 (GRCm39) critical splice donor site probably benign
R8313:Dab2ip UTSW 2 35,617,440 (GRCm39) missense probably damaging 1.00
R8387:Dab2ip UTSW 2 35,609,870 (GRCm39) missense probably damaging 0.97
R8422:Dab2ip UTSW 2 35,597,767 (GRCm39) missense probably damaging 0.97
R8560:Dab2ip UTSW 2 35,603,144 (GRCm39) missense probably damaging 1.00
R9263:Dab2ip UTSW 2 35,602,891 (GRCm39) missense probably damaging 1.00
R9342:Dab2ip UTSW 2 35,613,105 (GRCm39) missense possibly damaging 0.75
R9353:Dab2ip UTSW 2 35,598,851 (GRCm39) missense probably damaging 1.00
R9423:Dab2ip UTSW 2 35,599,966 (GRCm39) missense probably damaging 1.00
R9551:Dab2ip UTSW 2 35,605,330 (GRCm39) missense possibly damaging 0.60
R9563:Dab2ip UTSW 2 35,609,915 (GRCm39) nonsense probably null
X0011:Dab2ip UTSW 2 35,613,097 (GRCm39) nonsense probably null
Z1176:Dab2ip UTSW 2 35,598,880 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCTTTGCAGTCTAGGTGTC -3'
(R):5'- CCCAGACCTATGAGTATGAGGG -3'

Sequencing Primer
(F):5'- CCCGGGGCATTGATTCG -3'
(R):5'- CCTATGAGTATGAGGGAGGAGTGTC -3'
Posted On 2016-03-17