Incidental Mutation 'R0020:Nlrp4a'
ID 64739
Institutional Source Beutler Lab
Gene Symbol Nlrp4a
Ensembl Gene ENSMUSG00000040601
Gene Name NLR family, pyrin domain containing 4A
Synonyms Nalp-eta, E330028A19Rik, Nalp4a
MMRRC Submission 038315-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R0020 (G1)
Quality Score 84
Status Validated
Chromosome 7
Chromosomal Location 26134538-26175100 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 26149797 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 468 (H468L)
Ref Sequence ENSEMBL: ENSMUSP00000112441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068767] [ENSMUST00000119386] [ENSMUST00000146907]
AlphaFold Q8BU40
Predicted Effect probably damaging
Transcript: ENSMUST00000068767
AA Change: H468L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000066841
Gene: ENSMUSG00000040601
AA Change: H468L

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 4.9e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119386
AA Change: H468L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112441
Gene: ENSMUSG00000040601
AA Change: H468L

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 1.3e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146534
Predicted Effect possibly damaging
Transcript: ENSMUST00000146907
AA Change: H468L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.2642 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.4%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ado T C 10: 67,383,927 (GRCm39) D226G probably benign Het
Agfg2 C T 5: 137,652,064 (GRCm39) V432M probably benign Het
Atf2 T C 2: 73,676,628 (GRCm39) D122G possibly damaging Het
Brd10 A T 19: 29,693,597 (GRCm39) D2032E probably damaging Het
Cd2bp2 G A 7: 126,792,996 (GRCm39) T342M probably damaging Het
Cip2a A T 16: 48,821,975 (GRCm39) H201L probably damaging Het
Col6a3 T A 1: 90,739,272 (GRCm39) I319F probably damaging Het
Cst11 T A 2: 148,613,253 (GRCm39) Y24F probably damaging Het
Cstb T A 10: 78,263,170 (GRCm39) V65E probably benign Het
Cyp2j11 G A 4: 96,195,641 (GRCm39) H352Y probably benign Het
D130043K22Rik T A 13: 25,038,475 (GRCm39) probably benign Het
Dbh A G 2: 27,060,584 (GRCm39) probably benign Het
Dhdh T C 7: 45,137,528 (GRCm39) K53R probably benign Het
Drc3 A G 11: 60,261,371 (GRCm39) Y174C probably damaging Het
Ezr G T 17: 7,010,126 (GRCm39) Q308K probably damaging Het
F3 A T 3: 121,525,265 (GRCm39) N169Y probably damaging Het
Fbn2 G T 18: 58,238,236 (GRCm39) T587K probably damaging Het
Fhl5 A T 4: 25,200,054 (GRCm39) V260E probably benign Het
Glyr1 A G 16: 4,854,913 (GRCm39) I55T probably damaging Het
Gm12695 G C 4: 96,657,972 (GRCm39) P66A probably damaging Het
Gon4l G T 3: 88,766,244 (GRCm39) V428L probably damaging Het
Ighv6-5 T C 12: 114,380,241 (GRCm39) D92G probably null Het
Inhba A C 13: 16,200,949 (GRCm39) K170N possibly damaging Het
Kng2 A G 16: 22,816,046 (GRCm39) V317A probably benign Het
Larp1 T A 11: 57,940,849 (GRCm39) D658E probably damaging Het
Map3k14 T C 11: 103,118,500 (GRCm39) E562G probably damaging Het
Megf10 G T 18: 57,420,965 (GRCm39) V868F possibly damaging Het
Nap1l1 A C 10: 111,326,884 (GRCm39) E148D probably benign Het
Nphs1 G T 7: 30,162,633 (GRCm39) V357L probably benign Het
Or10aa3 T A 1: 173,878,413 (GRCm39) V158E probably damaging Het
Pclo A G 5: 14,719,687 (GRCm39) T1275A unknown Het
Pde4d T A 13: 110,091,104 (GRCm39) C35S possibly damaging Het
Pkd1l1 A G 11: 8,825,765 (GRCm39) probably benign Het
Pkd2 A G 5: 104,651,382 (GRCm39) E910G probably damaging Het
Pot1b T A 17: 55,960,429 (GRCm39) M634L probably benign Het
Ppp2r5c C T 12: 110,541,257 (GRCm39) Q469* probably null Het
Ppp6r2 T A 15: 89,143,342 (GRCm39) M163K probably damaging Het
Prss43 C A 9: 110,657,580 (GRCm39) probably benign Het
Rb1cc1 C A 1: 6,334,772 (GRCm39) N1444K possibly damaging Het
Rimoc1 T C 15: 4,021,350 (GRCm39) probably benign Het
Scube2 A G 7: 109,430,095 (GRCm39) probably benign Het
Slamf9 T C 1: 172,303,082 (GRCm39) S7P possibly damaging Het
Slc35b2 T A 17: 45,877,782 (GRCm39) M303K probably damaging Het
Slc4a7 T A 14: 14,796,108 (GRCm38) F1116I probably benign Het
Slco1a8 A T 6: 141,918,076 (GRCm39) V600E possibly damaging Het
Smarcad1 T A 6: 65,060,991 (GRCm39) probably benign Het
Tamalin T C 15: 101,128,433 (GRCm39) V157A probably damaging Het
Tns3 A C 11: 8,495,227 (GRCm39) probably null Het
Zfp282 T G 6: 47,856,943 (GRCm39) W59G probably damaging Het
Zfp746 C A 6: 48,041,641 (GRCm39) A362S probably benign Het
Other mutations in Nlrp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Nlrp4a APN 7 26,149,410 (GRCm39) missense possibly damaging 0.51
IGL00972:Nlrp4a APN 7 26,156,473 (GRCm39) missense probably benign
IGL01081:Nlrp4a APN 7 26,149,254 (GRCm39) missense probably benign 0.06
IGL01788:Nlrp4a APN 7 26,153,492 (GRCm39) missense probably benign 0.17
IGL02001:Nlrp4a APN 7 26,149,394 (GRCm39) missense probably benign 0.01
IGL02070:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02175:Nlrp4a APN 7 26,174,522 (GRCm39) missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02193:Nlrp4a APN 7 26,159,117 (GRCm39) missense probably damaging 1.00
IGL02197:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02200:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02202:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02207:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02237:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02240:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02658:Nlrp4a APN 7 26,149,138 (GRCm39) missense probably benign 0.43
IGL02743:Nlrp4a APN 7 26,159,240 (GRCm39) splice site probably benign
IGL02960:Nlrp4a APN 7 26,149,155 (GRCm39) missense probably benign 0.05
IGL03064:Nlrp4a APN 7 26,148,934 (GRCm39) missense probably benign 0.23
IGL03276:Nlrp4a APN 7 26,163,615 (GRCm39) missense probably damaging 1.00
BB002:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
BB012:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
D3080:Nlrp4a UTSW 7 26,143,766 (GRCm39) missense probably benign 0.22
P0019:Nlrp4a UTSW 7 26,149,062 (GRCm39) missense probably damaging 1.00
R0240:Nlrp4a UTSW 7 26,161,941 (GRCm39) missense probably benign 0.00
R0240:Nlrp4a UTSW 7 26,161,941 (GRCm39) missense probably benign 0.00
R0372:Nlrp4a UTSW 7 26,148,657 (GRCm39) splice site probably benign
R0466:Nlrp4a UTSW 7 26,162,045 (GRCm39) splice site probably benign
R0544:Nlrp4a UTSW 7 26,156,555 (GRCm39) missense probably benign 0.00
R1006:Nlrp4a UTSW 7 26,152,892 (GRCm39) missense probably benign 0.30
R1072:Nlrp4a UTSW 7 26,143,860 (GRCm39) missense probably damaging 1.00
R1432:Nlrp4a UTSW 7 26,163,622 (GRCm39) frame shift probably null
R1655:Nlrp4a UTSW 7 26,149,076 (GRCm39) missense possibly damaging 0.56
R1696:Nlrp4a UTSW 7 26,149,959 (GRCm39) missense probably damaging 1.00
R2041:Nlrp4a UTSW 7 26,149,611 (GRCm39) missense probably damaging 0.97
R2091:Nlrp4a UTSW 7 26,149,578 (GRCm39) missense probably damaging 1.00
R2163:Nlrp4a UTSW 7 26,152,822 (GRCm39) missense probably benign 0.00
R2174:Nlrp4a UTSW 7 26,148,849 (GRCm39) missense probably damaging 1.00
R2319:Nlrp4a UTSW 7 26,149,319 (GRCm39) missense probably benign 0.10
R2358:Nlrp4a UTSW 7 26,163,623 (GRCm39) missense probably benign 0.03
R2680:Nlrp4a UTSW 7 26,148,655 (GRCm39) splice site probably null
R3812:Nlrp4a UTSW 7 26,149,118 (GRCm39) missense probably benign
R4114:Nlrp4a UTSW 7 26,149,365 (GRCm39) missense probably damaging 1.00
R4664:Nlrp4a UTSW 7 26,148,943 (GRCm39) nonsense probably null
R4676:Nlrp4a UTSW 7 26,149,654 (GRCm39) missense probably damaging 1.00
R4708:Nlrp4a UTSW 7 26,163,533 (GRCm39) missense probably benign 0.00
R4728:Nlrp4a UTSW 7 26,174,515 (GRCm39) missense probably benign 0.24
R4815:Nlrp4a UTSW 7 26,150,233 (GRCm39) missense probably benign 0.00
R4831:Nlrp4a UTSW 7 26,149,844 (GRCm39) missense possibly damaging 0.92
R5007:Nlrp4a UTSW 7 26,161,905 (GRCm39) missense probably damaging 0.99
R5253:Nlrp4a UTSW 7 26,149,917 (GRCm39) missense probably benign 0.00
R5262:Nlrp4a UTSW 7 26,159,236 (GRCm39) critical splice donor site probably null
R5441:Nlrp4a UTSW 7 26,153,578 (GRCm39) missense probably damaging 1.00
R5639:Nlrp4a UTSW 7 26,156,455 (GRCm39) missense probably benign 0.02
R5641:Nlrp4a UTSW 7 26,149,589 (GRCm39) missense probably damaging 1.00
R5771:Nlrp4a UTSW 7 26,152,814 (GRCm39) missense probably damaging 1.00
R6312:Nlrp4a UTSW 7 26,148,821 (GRCm39) missense probably benign 0.11
R7131:Nlrp4a UTSW 7 26,149,258 (GRCm39) missense probably benign 0.21
R7149:Nlrp4a UTSW 7 26,149,863 (GRCm39) missense probably benign 0.00
R7348:Nlrp4a UTSW 7 26,143,698 (GRCm39) missense probably damaging 1.00
R7384:Nlrp4a UTSW 7 26,148,963 (GRCm39) missense not run
R7548:Nlrp4a UTSW 7 26,149,604 (GRCm39) missense probably damaging 1.00
R7566:Nlrp4a UTSW 7 26,148,670 (GRCm39) critical splice acceptor site probably null
R7646:Nlrp4a UTSW 7 26,148,987 (GRCm39) missense probably damaging 0.96
R7692:Nlrp4a UTSW 7 26,148,690 (GRCm39) missense probably benign 0.01
R7902:Nlrp4a UTSW 7 26,149,482 (GRCm39) missense possibly damaging 0.65
R7925:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
R7937:Nlrp4a UTSW 7 26,163,571 (GRCm39) missense probably benign 0.00
R7992:Nlrp4a UTSW 7 26,150,070 (GRCm39) missense possibly damaging 0.51
R8205:Nlrp4a UTSW 7 26,150,219 (GRCm39) missense probably benign
R8477:Nlrp4a UTSW 7 26,159,219 (GRCm39) missense probably benign
R8704:Nlrp4a UTSW 7 26,156,563 (GRCm39) missense probably benign 0.02
R8791:Nlrp4a UTSW 7 26,143,561 (GRCm39) splice site probably benign
R9220:Nlrp4a UTSW 7 26,149,523 (GRCm39) missense probably damaging 0.97
R9332:Nlrp4a UTSW 7 26,159,077 (GRCm39) missense probably damaging 0.99
T0975:Nlrp4a UTSW 7 26,149,062 (GRCm39) missense probably damaging 1.00
X0022:Nlrp4a UTSW 7 26,143,767 (GRCm39) missense probably damaging 0.99
Z1088:Nlrp4a UTSW 7 26,153,588 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGAGACCCAGTCTCCATTTGCCG -3'
(R):5'- TTTCCAGGCACTGATACAACTGACG -3'

Sequencing Primer
(F):5'- CATGTGGACTGACACGTTTG -3'
(R):5'- CTGACGTTTTATTTCTTGGGACAAC -3'
Posted On 2013-08-06