Incidental Mutation 'R0020:Nphs1'
ID64740
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Namenephrosis 1, nephrin
Synonymsnephrin
MMRRC Submission 038315-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0020 (G1)
Quality Score136
Status Validated
Chromosome7
Chromosomal Location30458315-30487223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 30463208 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 357 (V357L)
Ref Sequence ENSEMBL: ENSMUSP00000116500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
Predicted Effect probably benign
Transcript: ENSMUST00000006825
AA Change: V371L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: V371L

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126297
AA Change: V357L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: V357L

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152625
Meta Mutation Damage Score 0.2291 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.4%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,716,197 D2032E probably damaging Het
Ado T C 10: 67,548,097 D226G probably benign Het
Agfg2 C T 5: 137,653,802 V432M probably benign Het
Atf2 T C 2: 73,846,284 D122G possibly damaging Het
AW549877 T C 15: 3,991,868 probably benign Het
C330027C09Rik A T 16: 49,001,612 H201L probably damaging Het
Cd2bp2 G A 7: 127,193,824 T342M probably damaging Het
Col6a3 T A 1: 90,811,550 I319F probably damaging Het
Cst11 T A 2: 148,771,333 Y24F probably damaging Het
Cstb T A 10: 78,427,336 V65E probably benign Het
Cyp2j11 G A 4: 96,307,404 H352Y probably benign Het
D130043K22Rik T A 13: 24,854,492 probably benign Het
Dbh A G 2: 27,170,572 probably benign Het
Dhdh T C 7: 45,488,104 K53R probably benign Het
Drc3 A G 11: 60,370,545 Y174C probably damaging Het
Ezr G T 17: 6,742,727 Q308K probably damaging Het
F3 A T 3: 121,731,616 N169Y probably damaging Het
Fbn2 G T 18: 58,105,164 T587K probably damaging Het
Fhl5 A T 4: 25,200,054 V260E probably benign Het
Glyr1 A G 16: 5,037,049 I55T probably damaging Het
Gm12695 G C 4: 96,769,735 P66A probably damaging Het
Gm6614 A T 6: 141,972,350 V600E possibly damaging Het
Gon4l G T 3: 88,858,937 V428L probably damaging Het
Grasp T C 15: 101,230,552 V157A probably damaging Het
Ighv6-5 T C 12: 114,416,621 D92G probably null Het
Inhba A C 13: 16,026,364 K170N possibly damaging Het
Kng2 A G 16: 22,997,296 V317A probably benign Het
Larp1 T A 11: 58,050,023 D658E probably damaging Het
Map3k14 T C 11: 103,227,674 E562G probably damaging Het
Megf10 G T 18: 57,287,893 V868F possibly damaging Het
Nap1l1 A C 10: 111,491,023 E148D probably benign Het
Nlrp4a A T 7: 26,450,372 H468L probably damaging Het
Olfr432 T A 1: 174,050,847 V158E probably damaging Het
Pclo A G 5: 14,669,673 T1275A unknown Het
Pde4d T A 13: 109,954,570 C35S possibly damaging Het
Pkd1l1 A G 11: 8,875,765 probably benign Het
Pkd2 A G 5: 104,503,516 E910G probably damaging Het
Pot1b T A 17: 55,653,429 M634L probably benign Het
Ppp2r5c C T 12: 110,574,823 Q469* probably null Het
Ppp6r2 T A 15: 89,259,139 M163K probably damaging Het
Prss43 C A 9: 110,828,512 probably benign Het
Rb1cc1 C A 1: 6,264,548 N1444K possibly damaging Het
Scube2 A G 7: 109,830,888 probably benign Het
Slamf9 T C 1: 172,475,515 S7P possibly damaging Het
Slc35b2 T A 17: 45,566,856 M303K probably damaging Het
Slc4a7 T A 14: 14,796,108 F1116I probably benign Het
Smarcad1 T A 6: 65,084,007 probably benign Het
Tns3 A C 11: 8,545,227 probably null Het
Zfp282 T G 6: 47,880,009 W59G probably damaging Het
Zfp746 C A 6: 48,064,707 A362S probably benign Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1024:Nphs1 UTSW 7 30474277 missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R3765:Nphs1 UTSW 7 30471210 missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30467520 nonsense probably null
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4635:Nphs1 UTSW 7 30468007 missense probably benign 0.39
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30463232 missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5865:Nphs1 UTSW 7 30474385 missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30474544 missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R7767:Nphs1 UTSW 7 30463308 missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30482053 missense probably benign 0.02
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGTCCTACAACAGTGTGTCTGC -3'
(R):5'- TCTATAAGACCCAGGAACTGGAGCC -3'

Sequencing Primer
(F):5'- ATTCCCAGACGGCCTTATGTG -3'
(R):5'- AGGAACTGGAGCCTCAGTC -3'
Posted On2013-08-06