Incidental Mutation 'R0240:Nlrp4a'
ID 59310
Institutional Source Beutler Lab
Gene Symbol Nlrp4a
Ensembl Gene ENSMUSG00000040601
Gene Name NLR family, pyrin domain containing 4A
Synonyms E330028A19Rik, Nalp-eta, Nalp4a
MMRRC Submission 038478-MU
Accession Numbers

Genbank: NM_172896; MGI: 2443697

Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R0240 (G1)
Quality Score 195
Status Validated
Chromosome 7
Chromosomal Location 26435113-26476142 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26462516 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 863 (V863A)
Ref Sequence ENSEMBL: ENSMUSP00000146044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068767] [ENSMUST00000119386] [ENSMUST00000146907]
AlphaFold Q8BU40
Predicted Effect probably benign
Transcript: ENSMUST00000068767
AA Change: V863A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000066841
Gene: ENSMUSG00000040601
AA Change: V863A

PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 4.9e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119386
AA Change: V863A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112441
Gene: ENSMUSG00000040601
AA Change: V863A

PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 1.3e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146907
AA Change: V863A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 100% (112/112)
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,768,402 probably benign Het
Acsf3 T C 8: 122,780,181 L71P probably damaging Het
Adamts2 A T 11: 50,775,374 D399V probably damaging Het
Adck2 T A 6: 39,583,818 V380E probably benign Het
Alg11 T A 8: 22,065,452 V243D possibly damaging Het
Ankrd27 T A 7: 35,619,439 L585Q probably damaging Het
Atp7a T A X: 106,109,841 N1117K probably damaging Het
Cacna1b G A 2: 24,638,657 probably benign Het
Cacna1d T A 14: 30,096,969 M1210L probably benign Het
Cacna1s T C 1: 136,073,496 probably benign Het
Ccdc155 C T 7: 45,200,251 A83T probably benign Het
Chd7 T C 4: 8,852,670 probably benign Het
Col12a1 A T 9: 79,652,033 S1858T probably benign Het
Cotl1 C T 8: 119,840,324 W26* probably null Het
Csmd3 T C 15: 47,629,239 T3000A probably benign Het
Dcp1a T A 14: 30,484,594 probably benign Het
Ddhd2 A T 8: 25,739,590 probably null Het
Dnah8 T C 17: 30,765,679 I3117T probably damaging Het
Dnm3 G T 1: 162,353,625 Q162K probably benign Het
Dpy19l2 G T 9: 24,658,580 A359D probably damaging Het
Ece1 T A 4: 137,949,435 probably benign Het
Eif4g3 A G 4: 138,170,562 K1025R probably damaging Het
Eml2 C A 7: 19,184,872 Y82* probably null Het
Eml6 A G 11: 29,792,367 V1057A possibly damaging Het
Eral1 A G 11: 78,076,058 probably benign Het
Espl1 T C 15: 102,312,541 S911P probably benign Het
Fbxo8 A G 8: 56,590,261 probably benign Het
Flrt1 A T 19: 7,097,110 probably benign Het
Fndc7 A G 3: 108,858,919 probably benign Het
G3bp1 G A 11: 55,492,028 G139D probably damaging Het
Gabra6 C T 11: 42,314,947 V351I probably benign Het
Galc A T 12: 98,252,034 H186Q probably damaging Het
Ganab A G 19: 8,912,813 D702G possibly damaging Het
Gm13762 A T 2: 88,973,396 L165Q probably damaging Het
Hdac10 T C 15: 89,125,882 E291G possibly damaging Het
Hectd3 T G 4: 117,002,613 V749G probably damaging Het
Kcnh1 T A 1: 192,505,340 I703N probably benign Het
Kcnma1 G A 14: 23,494,579 T505I probably damaging Het
Kctd11 A G 11: 69,879,814 C133R probably damaging Het
Lama3 A T 18: 12,539,823 probably null Het
Lamb3 T C 1: 193,335,027 L842P probably damaging Het
Ldlr T C 9: 21,737,999 probably benign Het
Lipk G A 19: 34,046,810 R336H probably benign Het
Lrrc24 T A 15: 76,723,209 D58V probably damaging Het
Lrsam1 A G 2: 32,955,185 L106P probably damaging Het
Milr1 G A 11: 106,754,896 W88* probably null Het
Mmp10 A G 9: 7,506,543 D340G probably damaging Het
Mybpc1 T A 10: 88,555,738 Y285F possibly damaging Het
Ncoa3 A G 2: 166,054,400 T408A probably benign Het
Nefm T A 14: 68,121,134 K484* probably null Het
Nfasc A G 1: 132,601,983 S814P probably damaging Het
Nos1 C T 5: 117,867,883 P223S probably benign Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Olfr1440 A T 19: 12,394,963 E233D probably benign Het
Olfr155 T A 4: 43,854,512 S68T probably damaging Het
Olfr228 A G 2: 86,483,386 S119P possibly damaging Het
Osbpl5 T C 7: 143,741,669 probably null Het
Otog C A 7: 46,264,032 probably null Het
Pacs1 A T 19: 5,156,374 I261N possibly damaging Het
Pbx1 G A 1: 168,203,482 T189I possibly damaging Het
Pcnx T C 12: 81,947,018 I908T possibly damaging Het
Pdxdc1 A T 16: 13,879,445 W124R probably damaging Het
Phex C A X: 157,186,218 D587Y probably damaging Het
Plcb3 A T 19: 6,962,995 D435E probably benign Het
Plce1 A C 19: 38,728,886 K1373T probably damaging Het
Prkcd G A 14: 30,602,088 A311V probably damaging Het
Ptpn3 A T 4: 57,232,374 S421T probably benign Het
Ptprs T C 17: 56,436,087 probably null Het
Qrich1 A G 9: 108,534,134 D286G probably damaging Het
Rcc1 C A 4: 132,332,915 G393V probably damaging Het
Reln T C 5: 22,106,045 N290S probably benign Het
Rgl1 T C 1: 152,554,424 probably benign Het
Rhpn1 C T 15: 75,714,122 T628I probably benign Het
Rilp A G 11: 75,510,921 R176G probably benign Het
Riok3 C T 18: 12,155,227 A487V probably benign Het
Rnf224 T C 2: 25,236,207 T45A probably damaging Het
Rpa1 A G 11: 75,328,687 V137A probably benign Het
Rps6ka1 C A 4: 133,848,531 Q693H probably benign Het
Scn2a G T 2: 65,735,774 V1381F probably benign Het
Scp2 T A 4: 108,098,078 H112L probably benign Het
Sdk1 T C 5: 141,998,747 W696R probably damaging Het
Slc26a7 C A 4: 14,532,651 V408F probably damaging Het
Slc28a2 T A 2: 122,454,527 I332N probably benign Het
Slc37a3 A G 6: 39,337,238 V480A probably benign Het
Slc45a4 T A 15: 73,581,906 E674D probably benign Het
Smpd3 T C 8: 106,265,156 E255G probably damaging Het
Snx29 C T 16: 11,660,553 R658W probably damaging Het
Sppl2a A T 2: 126,920,336 M275K probably benign Het
Stac T C 9: 111,635,021 N59S probably damaging Het
Stk25 A T 1: 93,627,060 L131Q probably damaging Het
Tep1 C T 14: 50,863,029 probably benign Het
Thbs1 C A 2: 118,114,393 N229K probably damaging Het
Tmx2 A T 2: 84,675,842 H89Q probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tradd T C 8: 105,259,292 N209S possibly damaging Het
Trappc3l A T 10: 34,098,932 R119* probably null Het
Trmt1l G A 1: 151,457,454 probably benign Het
Ublcp1 G T 11: 44,458,277 Y243* probably null Het
Uhrf1bp1 T A 17: 27,895,870 probably benign Het
Usp24 C A 4: 106,414,404 C2158* probably null Het
Usp34 A T 11: 23,433,206 K2088N probably damaging Het
Vmn1r53 G C 6: 90,223,943 S133C probably damaging Het
Vmn2r52 A G 7: 10,159,400 V604A probably damaging Het
Vmn2r93 A G 17: 18,304,799 K240E probably benign Het
Wdr13 T G X: 8,128,045 D242A probably damaging Het
Wwp1 C T 4: 19,641,734 probably null Het
Zan G A 5: 137,398,362 H4311Y unknown Het
Zc3h12c C A 9: 52,144,083 R123L possibly damaging Het
Zfp125 A T 12: 20,900,561 noncoding transcript Het
Zfp318 C T 17: 46,396,813 P266S probably benign Het
Other mutations in Nlrp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Nlrp4a APN 7 26449985 missense possibly damaging 0.51
IGL00972:Nlrp4a APN 7 26457048 missense probably benign
IGL01081:Nlrp4a APN 7 26449829 missense probably benign 0.06
IGL01788:Nlrp4a APN 7 26454067 missense probably benign 0.17
IGL02001:Nlrp4a APN 7 26449969 missense probably benign 0.01
IGL02070:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02175:Nlrp4a APN 7 26475097 missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26459692 missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02197:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02200:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02202:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02207:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02237:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02240:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02658:Nlrp4a APN 7 26449713 missense probably benign 0.43
IGL02743:Nlrp4a APN 7 26459815 splice site probably benign
IGL02960:Nlrp4a APN 7 26449730 missense probably benign 0.05
IGL03064:Nlrp4a APN 7 26449509 missense probably benign 0.23
IGL03276:Nlrp4a APN 7 26464190 missense probably damaging 1.00
BB002:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
BB012:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
D3080:Nlrp4a UTSW 7 26444341 missense probably benign 0.22
P0019:Nlrp4a UTSW 7 26449637 missense probably damaging 1.00
R0020:Nlrp4a UTSW 7 26450372 missense probably damaging 1.00
R0240:Nlrp4a UTSW 7 26462516 missense probably benign 0.00
R0372:Nlrp4a UTSW 7 26449232 splice site probably benign
R0466:Nlrp4a UTSW 7 26462620 splice site probably benign
R0544:Nlrp4a UTSW 7 26457130 missense probably benign 0.00
R1006:Nlrp4a UTSW 7 26453467 missense probably benign 0.30
R1072:Nlrp4a UTSW 7 26444435 missense probably damaging 1.00
R1432:Nlrp4a UTSW 7 26464197 frame shift probably null
R1655:Nlrp4a UTSW 7 26449651 missense possibly damaging 0.56
R1696:Nlrp4a UTSW 7 26450534 missense probably damaging 1.00
R2041:Nlrp4a UTSW 7 26450186 missense probably damaging 0.97
R2091:Nlrp4a UTSW 7 26450153 missense probably damaging 1.00
R2163:Nlrp4a UTSW 7 26453397 missense probably benign 0.00
R2174:Nlrp4a UTSW 7 26449424 missense probably damaging 1.00
R2319:Nlrp4a UTSW 7 26449894 missense probably benign 0.10
R2358:Nlrp4a UTSW 7 26464198 missense probably benign 0.03
R2680:Nlrp4a UTSW 7 26449230 splice site probably null
R3812:Nlrp4a UTSW 7 26449693 missense probably benign
R4114:Nlrp4a UTSW 7 26449940 missense probably damaging 1.00
R4664:Nlrp4a UTSW 7 26449518 nonsense probably null
R4676:Nlrp4a UTSW 7 26450229 missense probably damaging 1.00
R4708:Nlrp4a UTSW 7 26464108 missense probably benign 0.00
R4728:Nlrp4a UTSW 7 26475090 missense probably benign 0.24
R4815:Nlrp4a UTSW 7 26450808 missense probably benign 0.00
R4831:Nlrp4a UTSW 7 26450419 missense possibly damaging 0.92
R5007:Nlrp4a UTSW 7 26462480 missense probably damaging 0.99
R5253:Nlrp4a UTSW 7 26450492 missense probably benign 0.00
R5262:Nlrp4a UTSW 7 26459811 critical splice donor site probably null
R5441:Nlrp4a UTSW 7 26454153 missense probably damaging 1.00
R5639:Nlrp4a UTSW 7 26457030 missense probably benign 0.02
R5641:Nlrp4a UTSW 7 26450164 missense probably damaging 1.00
R5771:Nlrp4a UTSW 7 26453389 missense probably damaging 1.00
R6312:Nlrp4a UTSW 7 26449396 missense probably benign 0.11
R7131:Nlrp4a UTSW 7 26449833 missense probably benign 0.21
R7149:Nlrp4a UTSW 7 26450438 missense probably benign 0.00
R7348:Nlrp4a UTSW 7 26444273 missense probably damaging 1.00
R7384:Nlrp4a UTSW 7 26449538 missense not run
R7548:Nlrp4a UTSW 7 26450179 missense probably damaging 1.00
R7566:Nlrp4a UTSW 7 26449245 critical splice acceptor site probably null
R7646:Nlrp4a UTSW 7 26449562 missense probably damaging 0.96
R7692:Nlrp4a UTSW 7 26449265 missense probably benign 0.01
R7902:Nlrp4a UTSW 7 26450057 missense possibly damaging 0.65
R7925:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
R7937:Nlrp4a UTSW 7 26464146 missense probably benign 0.00
R7992:Nlrp4a UTSW 7 26450645 missense possibly damaging 0.51
R8205:Nlrp4a UTSW 7 26450794 missense probably benign
R8477:Nlrp4a UTSW 7 26459794 missense probably benign
R8704:Nlrp4a UTSW 7 26457138 missense probably benign 0.02
R8791:Nlrp4a UTSW 7 26444136 splice site probably benign
R9220:Nlrp4a UTSW 7 26450098 missense probably damaging 0.97
R9332:Nlrp4a UTSW 7 26459652 missense probably damaging 0.99
T0975:Nlrp4a UTSW 7 26449637 missense probably damaging 1.00
X0022:Nlrp4a UTSW 7 26444342 missense probably damaging 0.99
Z1088:Nlrp4a UTSW 7 26454163 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- agccatctatctctccatccc -3'
Posted On 2013-07-11