Incidental Mutation 'R8791:Nlrp4a'
ID 686538
Institutional Source Beutler Lab
Gene Symbol Nlrp4a
Ensembl Gene ENSMUSG00000040601
Gene Name NLR family, pyrin domain containing 4A
Synonyms E330028A19Rik, Nalp-eta, Nalp4a
MMRRC Submission
Accession Numbers

Genbank: NM_172896; MGI: 2443697

Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock # R8791 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 26435113-26476142 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 26444136 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068767] [ENSMUST00000119386] [ENSMUST00000146907]
AlphaFold Q8BU40
Predicted Effect probably benign
Transcript: ENSMUST00000068767
SMART Domains Protein: ENSMUSP00000066841
Gene: ENSMUSG00000040601

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 4.9e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119386
SMART Domains Protein: ENSMUSP00000112441
Gene: ENSMUSG00000040601

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 1.3e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146907
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,187,260 Y654C probably damaging Het
4931422A03Rik G T 2: 103,992,677 T87K possibly damaging Het
Adar G A 3: 89,736,138 R442Q probably benign Het
Agtr1b T A 3: 20,316,116 S109C probably damaging Het
Akr1c6 T A 13: 4,449,374 Y248N probably benign Het
Alpk2 A T 18: 65,305,526 V932E probably benign Het
Apba3 T A 10: 81,269,270 S126T probably benign Het
Brca2 T A 5: 150,542,596 S1942T possibly damaging Het
Ccdc149 C T 5: 52,439,210 C20Y probably damaging Het
Cd63 C A 10: 128,912,202 N156K probably benign Het
Clvs1 A G 4: 9,429,807 E270G probably damaging Het
Dgki A T 6: 37,019,940 D574E probably damaging Het
Esrrb A G 12: 86,470,282 S63G probably damaging Het
Exoc1 C T 5: 76,535,565 R46C probably damaging Het
Fcgr4 C A 1: 171,019,908 A25D probably damaging Het
Fgf4 T C 7: 144,861,671 V56A probably benign Het
Gfpt2 A G 11: 49,823,216 I267V probably benign Het
Gm20939 A C 17: 94,877,220 H432P probably damaging Het
Gpr179 A T 11: 97,351,913 L35Q probably damaging Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Ildr1 T C 16: 36,708,400 I69T probably damaging Het
Lrfn1 A G 7: 28,459,919 D421G probably benign Het
Mmp15 C T 8: 95,369,660 Q360* probably null Het
Nfatc2 T C 2: 168,536,294 K484E probably damaging Het
Nkpd1 G C 7: 19,524,170 V625L probably benign Het
Nme9 T A 9: 99,468,248 I178N probably damaging Het
Nrp2 C T 1: 62,749,197 T352I probably damaging Het
Ntrk1 T C 3: 87,779,683 I723V probably damaging Het
Olfr469 C T 7: 107,823,350 V40M possibly damaging Het
Pias3 C A 3: 96,704,885 Q553K probably benign Het
Pnp2 T G 14: 50,963,416 H119Q probably benign Het
Rapgef6 T A 11: 54,568,469 D156E probably benign Het
Rint1 T C 5: 23,800,596 V92A probably damaging Het
Rnf148 A T 6: 23,654,994 M1K probably null Het
Rnh1 C T 7: 141,162,433 R404H probably benign Het
Slc4a8 T C 15: 100,807,253 V832A possibly damaging Het
Snx31 A T 15: 36,537,532 C167S probably benign Het
Spata13 C T 14: 60,691,826 R278C probably damaging Het
Spg20 A G 3: 55,121,679 D297G probably benign Het
Tmc1 T C 19: 20,789,845 T716A probably benign Het
Tpi1 A G 6: 124,812,520 V164A probably damaging Het
Trim17 A G 11: 58,971,176 S345G probably benign Het
Vmn1r199 T A 13: 22,383,517 L327Q probably damaging Het
Washc4 C T 10: 83,550,884 T124I probably benign Het
Wdr76 C T 2: 121,527,003 T180I probably benign Het
Zcchc8 T C 5: 123,707,299 N333D probably benign Het
Zfp516 T C 18: 82,957,335 S553P probably damaging Het
Other mutations in Nlrp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Nlrp4a APN 7 26449985 missense possibly damaging 0.51
IGL00972:Nlrp4a APN 7 26457048 missense probably benign
IGL01081:Nlrp4a APN 7 26449829 missense probably benign 0.06
IGL01788:Nlrp4a APN 7 26454067 missense probably benign 0.17
IGL02001:Nlrp4a APN 7 26449969 missense probably benign 0.01
IGL02070:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02175:Nlrp4a APN 7 26475097 missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26459692 missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02197:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02200:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02202:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02207:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02237:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02240:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02658:Nlrp4a APN 7 26449713 missense probably benign 0.43
IGL02743:Nlrp4a APN 7 26459815 splice site probably benign
IGL02960:Nlrp4a APN 7 26449730 missense probably benign 0.05
IGL03064:Nlrp4a APN 7 26449509 missense probably benign 0.23
IGL03276:Nlrp4a APN 7 26464190 missense probably damaging 1.00
BB002:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
BB012:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
D3080:Nlrp4a UTSW 7 26444341 missense probably benign 0.22
P0019:Nlrp4a UTSW 7 26449637 missense probably damaging 1.00
R0020:Nlrp4a UTSW 7 26450372 missense probably damaging 1.00
R0240:Nlrp4a UTSW 7 26462516 missense probably benign 0.00
R0240:Nlrp4a UTSW 7 26462516 missense probably benign 0.00
R0372:Nlrp4a UTSW 7 26449232 splice site probably benign
R0466:Nlrp4a UTSW 7 26462620 splice site probably benign
R0544:Nlrp4a UTSW 7 26457130 missense probably benign 0.00
R1006:Nlrp4a UTSW 7 26453467 missense probably benign 0.30
R1072:Nlrp4a UTSW 7 26444435 missense probably damaging 1.00
R1432:Nlrp4a UTSW 7 26464197 frame shift probably null
R1655:Nlrp4a UTSW 7 26449651 missense possibly damaging 0.56
R1696:Nlrp4a UTSW 7 26450534 missense probably damaging 1.00
R2041:Nlrp4a UTSW 7 26450186 missense probably damaging 0.97
R2091:Nlrp4a UTSW 7 26450153 missense probably damaging 1.00
R2163:Nlrp4a UTSW 7 26453397 missense probably benign 0.00
R2174:Nlrp4a UTSW 7 26449424 missense probably damaging 1.00
R2319:Nlrp4a UTSW 7 26449894 missense probably benign 0.10
R2358:Nlrp4a UTSW 7 26464198 missense probably benign 0.03
R2680:Nlrp4a UTSW 7 26449230 splice site probably null
R3812:Nlrp4a UTSW 7 26449693 missense probably benign
R4114:Nlrp4a UTSW 7 26449940 missense probably damaging 1.00
R4664:Nlrp4a UTSW 7 26449518 nonsense probably null
R4676:Nlrp4a UTSW 7 26450229 missense probably damaging 1.00
R4708:Nlrp4a UTSW 7 26464108 missense probably benign 0.00
R4728:Nlrp4a UTSW 7 26475090 missense probably benign 0.24
R4815:Nlrp4a UTSW 7 26450808 missense probably benign 0.00
R4831:Nlrp4a UTSW 7 26450419 missense possibly damaging 0.92
R5007:Nlrp4a UTSW 7 26462480 missense probably damaging 0.99
R5253:Nlrp4a UTSW 7 26450492 missense probably benign 0.00
R5262:Nlrp4a UTSW 7 26459811 critical splice donor site probably null
R5441:Nlrp4a UTSW 7 26454153 missense probably damaging 1.00
R5639:Nlrp4a UTSW 7 26457030 missense probably benign 0.02
R5641:Nlrp4a UTSW 7 26450164 missense probably damaging 1.00
R5771:Nlrp4a UTSW 7 26453389 missense probably damaging 1.00
R6312:Nlrp4a UTSW 7 26449396 missense probably benign 0.11
R7131:Nlrp4a UTSW 7 26449833 missense probably benign 0.21
R7149:Nlrp4a UTSW 7 26450438 missense probably benign 0.00
R7348:Nlrp4a UTSW 7 26444273 missense probably damaging 1.00
R7384:Nlrp4a UTSW 7 26449538 missense not run
R7548:Nlrp4a UTSW 7 26450179 missense probably damaging 1.00
R7566:Nlrp4a UTSW 7 26449245 critical splice acceptor site probably null
R7646:Nlrp4a UTSW 7 26449562 missense probably damaging 0.96
R7692:Nlrp4a UTSW 7 26449265 missense probably benign 0.01
R7902:Nlrp4a UTSW 7 26450057 missense possibly damaging 0.65
R7925:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
R7937:Nlrp4a UTSW 7 26464146 missense probably benign 0.00
R7992:Nlrp4a UTSW 7 26450645 missense possibly damaging 0.51
R8205:Nlrp4a UTSW 7 26450794 missense probably benign
R8477:Nlrp4a UTSW 7 26459794 missense probably benign
R8704:Nlrp4a UTSW 7 26457138 missense probably benign 0.02
R9220:Nlrp4a UTSW 7 26450098 missense probably damaging 0.97
R9332:Nlrp4a UTSW 7 26459652 missense probably damaging 0.99
T0975:Nlrp4a UTSW 7 26449637 missense probably damaging 1.00
X0022:Nlrp4a UTSW 7 26444342 missense probably damaging 0.99
Z1088:Nlrp4a UTSW 7 26454163 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTCCACTCCCAAAAGTTCTACATC -3'
(R):5'- CTGCAAAACCTCCTGTTTGAG -3'

Sequencing Primer
(F):5'- TCTTGCAGGCCAGACATATAG -3'
(R):5'- GGAACTCCTTAAACTTTACGAATTCC -3'
Posted On 2021-10-20