Incidental Mutation 'R8454:Adgrg7'
ID654959
Institutional Source Beutler Lab
Gene Symbol Adgrg7
Ensembl Gene ENSMUSG00000022755
Gene Nameadhesion G protein-coupled receptor G7
SynonymsGpr128, 9130020O16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8454 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location56724609-56795855 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to G at 56795682 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023437]
Predicted Effect probably benign
Transcript: ENSMUST00000023437
SMART Domains Protein: ENSMUSP00000023437
Gene: ENSMUSG00000022755

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
SCOP:d1edmb_ 52 76 1e-3 SMART
GPS 376 424 6.16e-8 SMART
Pfam:7tm_2 428 712 4.5e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight gain and increased frequency of peristalsis and slow wave potential in the small intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,792,572 F493Y probably benign Het
Abcc10 C A 17: 46,324,177 G300V possibly damaging Het
Agt G A 8: 124,564,103 T155M probably benign Het
Atp8b3 A G 10: 80,525,799 V763A probably benign Het
Btn1a1 C A 13: 23,464,250 V138L probably benign Het
Cd163 A T 6: 124,328,965 N1109I probably benign Het
Cideb T A 14: 55,755,141 Q106L possibly damaging Het
Cntn1 A G 15: 92,232,249 T126A probably benign Het
Dusp27 A T 1: 166,108,133 N165K probably damaging Het
Elfn1 T C 5: 139,971,471 Y77H probably damaging Het
Eml3 A G 19: 8,934,994 H386R probably damaging Het
Fbxo21 A G 5: 117,995,414 D413G probably damaging Het
Fkbp8 T A 8: 70,531,763 probably null Het
Fzd1 T C 5: 4,757,336 Q82R probably benign Het
Gast T C 11: 100,336,568 L29P probably benign Het
Glb1l2 C A 9: 26,806,417 probably benign Het
Gm1110 C G 9: 26,883,280 Q483H probably benign Het
Gm1110 T A 9: 26,883,281 Q483L probably benign Het
Gm5737 T A 7: 120,831,180 V420E possibly damaging Het
Gpc6 T C 14: 116,925,979 L15P probably damaging Het
Hagh C A 17: 24,857,562 S161* probably null Het
Hrh1 A G 6: 114,480,853 D365G probably benign Het
Ighv1-36 A T 12: 114,879,940 M100K probably damaging Het
Itgb8 A T 12: 119,170,778 V518D probably benign Het
Krt82 T C 15: 101,541,803 Y486C probably damaging Het
Lmbr1l A G 15: 98,912,476 S85P probably damaging Het
Met A G 6: 17,491,769 S177G probably damaging Het
Myl9 T A 2: 156,781,128 I162N possibly damaging Het
Npat T A 9: 53,566,951 N973K possibly damaging Het
Olfr493 A T 7: 108,346,682 C100S probably damaging Het
Pcdhga12 A T 18: 37,768,137 D674V possibly damaging Het
Phtf1 T A 3: 104,004,449 N702K probably damaging Het
Plaa A T 4: 94,569,477 I752N probably damaging Het
Pnpla2 T C 7: 141,458,098 C194R probably damaging Het
Rnaseh2a T C 8: 84,965,147 N133S probably benign Het
Rps6ka1 T A 4: 133,848,553 Q685L probably benign Het
Ryr1 C A 7: 29,015,717 G4661C unknown Het
Samd13 T A 3: 146,646,402 M65L probably benign Het
Sec22c A G 9: 121,695,655 S21P probably damaging Het
Sh3d19 C A 3: 86,107,022 T431K probably benign Het
Sin3b A G 8: 72,741,480 M277V probably benign Het
Sis T C 3: 72,947,501 T468A possibly damaging Het
Slitrk3 T C 3: 73,049,180 N753S probably benign Het
Slitrk6 C A 14: 110,752,046 L76F probably damaging Het
Stk3 C T 15: 34,876,724 A478T probably damaging Het
Sugp1 C A 8: 70,071,597 Y617* probably null Het
Tinag T C 9: 77,031,695 D167G probably damaging Het
Tk2 A G 8: 104,241,114 probably null Het
Tmem209 A T 6: 30,489,309 V514D probably damaging Het
Tmprss9 A G 10: 80,887,486 H260R probably benign Het
Tnfrsf14 T A 4: 154,926,655 Y83F possibly damaging Het
Tnfrsf8 A T 4: 145,287,983 D285E probably benign Het
Togaram2 C G 17: 71,697,878 A310G probably benign Het
Trpv3 A G 11: 73,291,622 Y544C probably damaging Het
Ttl T A 2: 129,066,184 V13D probably damaging Het
Usp40 A T 1: 87,980,972 D602E probably benign Het
Vamp5 A G 6: 72,370,393 probably benign Het
Vmn2r65 T A 7: 84,940,194 H838L possibly damaging Het
Wdr63 T C 3: 146,097,227 K70E probably damaging Het
Zfp960 T A 17: 17,088,199 Y392N probably benign Het
Other mutations in Adgrg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Adgrg7 APN 16 56747919 critical splice donor site probably null
IGL03122:Adgrg7 APN 16 56770362 splice site probably benign
R0632:Adgrg7 UTSW 16 56742589 missense possibly damaging 0.89
R0673:Adgrg7 UTSW 16 56773486 missense possibly damaging 0.48
R1690:Adgrg7 UTSW 16 56795630 missense probably damaging 0.99
R2009:Adgrg7 UTSW 16 56761873 missense probably benign 0.08
R2017:Adgrg7 UTSW 16 56732806 missense probably benign 0.02
R2132:Adgrg7 UTSW 16 56767918 missense probably damaging 1.00
R2153:Adgrg7 UTSW 16 56752428 missense possibly damaging 0.75
R2229:Adgrg7 UTSW 16 56752403 missense probably benign
R2436:Adgrg7 UTSW 16 56761945 missense possibly damaging 0.78
R2878:Adgrg7 UTSW 16 56750454 missense probably benign 0.14
R2981:Adgrg7 UTSW 16 56750406 critical splice donor site probably null
R4014:Adgrg7 UTSW 16 56742288 missense probably damaging 1.00
R4023:Adgrg7 UTSW 16 56730298 missense probably damaging 1.00
R4024:Adgrg7 UTSW 16 56730298 missense probably damaging 1.00
R4026:Adgrg7 UTSW 16 56730298 missense probably damaging 1.00
R4551:Adgrg7 UTSW 16 56748012 missense probably damaging 1.00
R4834:Adgrg7 UTSW 16 56732869 missense probably damaging 1.00
R5041:Adgrg7 UTSW 16 56730348 missense probably benign 0.21
R5145:Adgrg7 UTSW 16 56742319 missense probably benign 0.04
R5377:Adgrg7 UTSW 16 56730306 missense possibly damaging 0.68
R5549:Adgrg7 UTSW 16 56750427 missense probably damaging 1.00
R5915:Adgrg7 UTSW 16 56730385 splice site probably null
R5957:Adgrg7 UTSW 16 56773427 missense probably damaging 0.96
R6146:Adgrg7 UTSW 16 56773466 missense probably benign 0.21
R6198:Adgrg7 UTSW 16 56777193 missense possibly damaging 0.64
R6233:Adgrg7 UTSW 16 56778642 missense possibly damaging 0.52
R6337:Adgrg7 UTSW 16 56752425 missense probably damaging 0.96
R6633:Adgrg7 UTSW 16 56730286 missense probably benign 0.05
R6693:Adgrg7 UTSW 16 56770224 missense probably damaging 0.97
R6812:Adgrg7 UTSW 16 56795798 start gained probably benign
R6841:Adgrg7 UTSW 16 56750424 missense probably damaging 1.00
R6868:Adgrg7 UTSW 16 56773476 missense probably benign
R7076:Adgrg7 UTSW 16 56742406 missense probably damaging 1.00
R7146:Adgrg7 UTSW 16 56730242 missense probably damaging 1.00
R7232:Adgrg7 UTSW 16 56777152 splice site probably null
R7266:Adgrg7 UTSW 16 56770311 missense probably benign 0.00
R7376:Adgrg7 UTSW 16 56724979 missense probably damaging 1.00
R7390:Adgrg7 UTSW 16 56732844 missense probably damaging 0.98
R7401:Adgrg7 UTSW 16 56742418 missense probably benign 0.43
R7496:Adgrg7 UTSW 16 56732857 missense probably benign
R7540:Adgrg7 UTSW 16 56750429 missense probably damaging 1.00
R8147:Adgrg7 UTSW 16 56742513 missense probably damaging 1.00
R8354:Adgrg7 UTSW 16 56795682 start gained probably benign
R8372:Adgrg7 UTSW 16 56795751 start gained probably benign
R8393:Adgrg7 UTSW 16 56762114 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTCCCTGGCACTGAAATATC -3'
(R):5'- ATCTCCCTCGGTGAAGAATGAG -3'

Sequencing Primer
(F):5'- GCAGAGTCAGAGAATCAATGCCATC -3'
(R):5'- TCCCTCGGTGAAGAATGAGCATAC -3'
Posted On2020-10-20