Incidental Mutation 'R8520:Ebf3'
ID 658593
Institutional Source Beutler Lab
Gene Symbol Ebf3
Ensembl Gene ENSMUSG00000010476
Gene Name early B cell factor 3
Synonyms Olf-1/EBF-like 2, O/E-2, 3110018A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8520 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 137193673-137314445 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 137201124 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033378] [ENSMUST00000106118] [ENSMUST00000168203] [ENSMUST00000169486] [ENSMUST00000209578] [ENSMUST00000210774]
AlphaFold O08791
Predicted Effect probably null
Transcript: ENSMUST00000033378
SMART Domains Protein: ENSMUSP00000033378
Gene: ENSMUSG00000010476

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106118
SMART Domains Protein: ENSMUSP00000101724
Gene: ENSMUSG00000010476

DomainStartEndE-ValueType
Pfam:COE1_DBD 17 247 2.6e-151 PFAM
IPT 262 346 2.09e-7 SMART
HLH 347 396 1.43e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000168203
SMART Domains Protein: ENSMUSP00000130334
Gene: ENSMUSG00000010476

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169486
SMART Domains Protein: ENSMUSP00000132563
Gene: ENSMUSG00000010476

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000209578
Predicted Effect probably null
Transcript: ENSMUST00000210774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the early B-cell factor (EBF) family of DNA binding transcription factors. EBF proteins are involved in B-cell differentiation, bone development and neurogenesis, and may also function as tumor suppressors. The encoded protein inhibits cell survival through the regulation of genes involved in cell cycle arrest and apoptosis, and aberrant methylation or deletion of this gene may play a role in multiple malignancies including glioblastoma multiforme and gastric carcinoma. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice die perinatally and exhibit impaired olfactory neuron projection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,609 F136L possibly damaging Het
A430033K04Rik T A 5: 138,646,706 N284K possibly damaging Het
Abcb1a T C 5: 8,685,346 I151T possibly damaging Het
Adam28 C T 14: 68,642,083 G172D probably damaging Het
Adcy6 A G 15: 98,604,160 V191A probably benign Het
Ankrd52 T C 10: 128,389,490 L911P probably damaging Het
C5ar1 A G 7: 16,248,151 S315P probably damaging Het
Cubn A G 2: 13,308,520 probably null Het
Dlec1 T C 9: 119,112,209 S276P probably benign Het
Dnah14 T A 1: 181,653,638 I1564N probably damaging Het
Dsg2 G A 18: 20,579,451 G171R probably damaging Het
Dusp13 C A 14: 21,743,470 G208* probably null Het
Fbn2 A T 18: 58,038,198 probably null Het
Fbxo27 A G 7: 28,693,342 D16G probably benign Het
G6pc3 A G 11: 102,193,108 S187G probably benign Het
Gucy2d G A 7: 98,472,306 V995I probably null Het
Hmcn2 C A 2: 31,354,714 P728T probably damaging Het
Il1r2 T C 1: 40,105,339 L62P probably damaging Het
Ints7 T C 1: 191,582,491 S63P probably damaging Het
Mcf2l C A 8: 12,880,089 D36E probably benign Het
Mfsd13b T G 7: 120,991,363 I109S probably benign Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Mydgf C A 17: 56,183,734 probably null Het
Nanog A T 6: 122,713,516 L268F possibly damaging Het
Olfr305 A T 7: 86,364,263 C25S probably benign Het
Olfr536 T A 7: 140,504,402 D19V probably benign Het
Otud4 T A 8: 79,659,267 N256K probably damaging Het
P2rx1 A T 11: 73,008,953 D128V probably benign Het
Pappa G A 4: 65,335,764 V1552I probably benign Het
Pax8 A T 2: 24,443,022 F103I probably damaging Het
Ptk2b T A 14: 66,174,755 S396C probably damaging Het
Rnf148 A G 6: 23,654,170 Y276H probably damaging Het
Sec11c A T 18: 65,814,840 I93L probably damaging Het
Serpinb2 T A 1: 107,523,180 N217K probably benign Het
Slc2a13 T A 15: 91,572,902 T66S probably damaging Het
Slc4a3 T C 1: 75,549,862 M9T probably benign Het
Sord G A 2: 122,256,942 V176I possibly damaging Het
Thbs4 G A 13: 92,754,284 Q892* probably null Het
Thsd7b T A 1: 129,921,420 D956E probably benign Het
Tmem251 T A 12: 102,744,172 probably null Het
Topbp1 T A 9: 103,308,977 probably null Het
Tst T C 15: 78,405,253 E194G probably damaging Het
Ttk T A 9: 83,857,327 S484T possibly damaging Het
U2surp A G 9: 95,502,554 S26P possibly damaging Het
Ugt2b37 C T 5: 87,240,855 A500T probably benign Het
Utrn A T 10: 12,670,186 Y1669* probably null Het
Vmn2r23 A T 6: 123,741,656 Q656L probably damaging Het
Wdr7 A G 18: 63,987,160 N1424S probably benign Het
Xkr9 A G 1: 13,701,379 D373G probably benign Het
Zfp984 T A 4: 147,756,211 Y61F probably benign Het
Other mutations in Ebf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Ebf3 APN 7 137225896 splice site probably benign
IGL01938:Ebf3 APN 7 137309318 missense probably damaging 1.00
IGL02076:Ebf3 APN 7 137231301 missense possibly damaging 0.61
IGL02260:Ebf3 APN 7 137206190 missense probably damaging 1.00
IGL02303:Ebf3 APN 7 137309365 missense probably benign 0.01
IGL02828:Ebf3 APN 7 137307518 missense probably damaging 0.98
IGL03211:Ebf3 APN 7 137231304 missense probably benign 0.21
R0885:Ebf3 UTSW 7 137225884 missense probably benign 0.10
R0962:Ebf3 UTSW 7 137225203 missense probably damaging 0.99
R1166:Ebf3 UTSW 7 137313167 splice site probably benign
R1255:Ebf3 UTSW 7 137225212 missense probably benign 0.35
R1804:Ebf3 UTSW 7 137200521 missense possibly damaging 0.89
R4298:Ebf3 UTSW 7 137225229 missense possibly damaging 0.95
R4393:Ebf3 UTSW 7 137225157 missense probably damaging 0.99
R5061:Ebf3 UTSW 7 137313559 missense possibly damaging 0.57
R5880:Ebf3 UTSW 7 137198638 missense probably benign 0.04
R6024:Ebf3 UTSW 7 137200535 missense probably damaging 1.00
R6109:Ebf3 UTSW 7 137206226 missense probably damaging 1.00
R6634:Ebf3 UTSW 7 137201160 missense probably damaging 0.99
R6958:Ebf3 UTSW 7 137199265 missense possibly damaging 0.66
R6997:Ebf3 UTSW 7 137225265 missense probably damaging 0.97
R7578:Ebf3 UTSW 7 137313532 missense probably damaging 1.00
R7771:Ebf3 UTSW 7 137309363 missense probably damaging 1.00
R8133:Ebf3 UTSW 7 137313143 missense probably damaging 1.00
R8185:Ebf3 UTSW 7 137225878 missense possibly damaging 0.87
R8356:Ebf3 UTSW 7 137199187 missense probably benign 0.41
R8456:Ebf3 UTSW 7 137199187 missense probably benign 0.41
R9025:Ebf3 UTSW 7 137312369 missense possibly damaging 0.94
R9086:Ebf3 UTSW 7 137199265 missense possibly damaging 0.66
RF022:Ebf3 UTSW 7 137313942 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCACCTGCTACTGAGTACTATGG -3'
(R):5'- GCCTTTCAGAGAGTTCATGGC -3'

Sequencing Primer
(F):5'- CTGCTACTGAGTACTATGGAACTTC -3'
(R):5'- CTTTCAGAGAGTTCATGGCAGAGG -3'
Posted On 2021-01-18