Mutagenetix > Incidental Mutations

Incidental Mutation 'R8520:Otud4'

658596

Institutional Source

Beutler Lab

Gene Symbol

Otud4

Ensembl Gene

ENSMUSG00000036990

Gene Name

OTU domain containing 4

Synonyms

4930431L18Rik, D8Ertd69e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.131) question?

Stock #

R8520 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79639618-79677724 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79659267 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 256 (N256K)

Ref Sequence

ENSEMBL: ENSMUSP00000134097 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000173078] [ENSMUST00000173286]

AlphaFold

B2RRE7

Predicted Effect

probably damaging
Transcript: ENSMUST00000173078
AA Change: N256K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133939
Gene: ENSMUSG00000036990
AA Change: N256K

Domain	Start	End	E-Value	Type
Pfam:OTU	40	154	3.4e-17	PFAM
low complexity region	189	213	N/A	INTRINSIC
Blast:TUDOR	280	335	2e-7	BLAST
low complexity region	392	405	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	543	555	N/A	INTRINSIC
low complexity region	1014	1025	N/A	INTRINSIC
low complexity region	1082	1104	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000173286
AA Change: N256K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134097
Gene: ENSMUSG00000036990
AA Change: N256K

Domain	Start	End	E-Value	Type
Pfam:OTU	40	149	5.3e-21	PFAM
low complexity region	189	213	N/A	INTRINSIC
Blast:TUDOR	280	334	9e-9	BLAST
low complexity region	391	404	N/A	INTRINSIC
low complexity region	472	485	N/A	INTRINSIC
low complexity region	542	554	N/A	INTRINSIC
low complexity region	1013	1024	N/A	INTRINSIC
low complexity region	1081	1103	N/A	INTRINSIC

Meta Mutation Damage Score

0.6676

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alternatively spliced transcript variants have been found for this gene. The smaller protein isoform encoded by the shorter transcript variant is found only in HIV-1 infected cells. [provided by RefSeq, Jul 2010]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	T	13: 59,690,609	F136L	possibly damaging	Het
A430033K04Rik	T	A	5: 138,646,706	N284K	possibly damaging	Het
Abcb1a	T	C	5: 8,685,346	I151T	possibly damaging	Het
Adam28	C	T	14: 68,642,083	G172D	probably damaging	Het
Adcy6	A	G	15: 98,604,160	V191A	probably benign	Het
Ankrd52	T	C	10: 128,389,490	L911P	probably damaging	Het
C5ar1	A	G	7: 16,248,151	S315P	probably damaging	Het
Cubn	A	G	2: 13,308,520		probably null	Het
Dlec1	T	C	9: 119,112,209	S276P	probably benign	Het
Dnah14	T	A	1: 181,653,638	I1564N	probably damaging	Het
Dsg2	G	A	18: 20,579,451	G171R	probably damaging	Het
Dusp13	C	A	14: 21,743,470	G208*	probably null	Het
Ebf3	A	C	7: 137,201,124		probably null	Het
Fbn2	A	T	18: 58,038,198		probably null	Het
Fbxo27	A	G	7: 28,693,342	D16G	probably benign	Het
G6pc3	A	G	11: 102,193,108	S187G	probably benign	Het
Gucy2d	G	A	7: 98,472,306	V995I	probably null	Het
Hmcn2	C	A	2: 31,354,714	P728T	probably damaging	Het
Il1r2	T	C	1: 40,105,339	L62P	probably damaging	Het
Ints7	T	C	1: 191,582,491	S63P	probably damaging	Het
Mcf2l	C	A	8: 12,880,089	D36E	probably benign	Het
Mfsd13b	T	G	7: 120,991,363	I109S	probably benign	Het
Mier2	G	A	10: 79,542,429	H385Y	possibly damaging	Het
Mydgf	C	A	17: 56,183,734		probably null	Het
Nanog	A	T	6: 122,713,516	L268F	possibly damaging	Het
Olfr305	A	T	7: 86,364,263	C25S	probably benign	Het
Olfr536	T	A	7: 140,504,402	D19V	probably benign	Het
P2rx1	A	T	11: 73,008,953	D128V	probably benign	Het
Pappa	G	A	4: 65,335,764	V1552I	probably benign	Het
Pax8	A	T	2: 24,443,022	F103I	probably damaging	Het
Ptk2b	T	A	14: 66,174,755	S396C	probably damaging	Het
Rnf148	A	G	6: 23,654,170	Y276H	probably damaging	Het
Sec11c	A	T	18: 65,814,840	I93L	probably damaging	Het
Serpinb2	T	A	1: 107,523,180	N217K	probably benign	Het
Slc2a13	T	A	15: 91,572,902	T66S	probably damaging	Het
Slc4a3	T	C	1: 75,549,862	M9T	probably benign	Het
Sord	G	A	2: 122,256,942	V176I	possibly damaging	Het
Thbs4	G	A	13: 92,754,284	Q892*	probably null	Het
Thsd7b	T	A	1: 129,921,420	D956E	probably benign	Het
Tmem251	T	A	12: 102,744,172		probably null	Het
Topbp1	T	A	9: 103,308,977		probably null	Het
Tst	T	C	15: 78,405,253	E194G	probably damaging	Het
Ttk	T	A	9: 83,857,327	S484T	possibly damaging	Het
U2surp	A	G	9: 95,502,554	S26P	possibly damaging	Het
Ugt2b37	C	T	5: 87,240,855	A500T	probably benign	Het
Utrn	A	T	10: 12,670,186	Y1669*	probably null	Het
Vmn2r23	A	T	6: 123,741,656	Q656L	probably damaging	Het
Wdr7	A	G	18: 63,987,160	N1424S	probably benign	Het
Xkr9	A	G	1: 13,701,379	D373G	probably benign	Het
Zfp984	T	A	4: 147,756,211	Y61F	probably benign	Het

Other mutations in Otud4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Otud4	APN	8	79672881	missense	probably damaging	0.99
IGL01353:Otud4	APN	8	79665021	missense	probably benign
IGL01371:Otud4	APN	8	79673761	missense	probably damaging	1.00
IGL01782:Otud4	APN	8	79673011	missense	possibly damaging	0.95
IGL01912:Otud4	APN	8	79673837	missense	probably benign
IGL02294:Otud4	APN	8	79664977	splice site	probably benign
IGL02830:Otud4	APN	8	79673301	missense	probably benign	0.00
IGL03063:Otud4	APN	8	79663790	missense	probably benign	0.01
IGL03077:Otud4	APN	8	79673458	missense	probably damaging	0.97
R0437:Otud4	UTSW	8	79669997	missense	probably benign	0.02
R1024:Otud4	UTSW	8	79664093	missense	probably benign	0.01
R1118:Otud4	UTSW	8	79653351	splice site	probably benign
R1296:Otud4	UTSW	8	79673974	missense	unknown
R1321:Otud4	UTSW	8	79669950	missense	probably benign	0.03
R1674:Otud4	UTSW	8	79673147	missense	probably benign	0.12
R1736:Otud4	UTSW	8	79651665	splice site	probably benign
R1815:Otud4	UTSW	8	79639989	nonsense	probably null
R1950:Otud4	UTSW	8	79646332	missense	probably damaging	0.99
R1985:Otud4	UTSW	8	79640012	missense	probably damaging	1.00
R2173:Otud4	UTSW	8	79668464	missense	probably damaging	1.00
R2869:Otud4	UTSW	8	79661073	missense	possibly damaging	0.82
R2869:Otud4	UTSW	8	79661073	missense	possibly damaging	0.82
R2870:Otud4	UTSW	8	79661073	missense	possibly damaging	0.82
R2870:Otud4	UTSW	8	79661073	missense	possibly damaging	0.82
R2872:Otud4	UTSW	8	79661073	missense	possibly damaging	0.82
R2872:Otud4	UTSW	8	79661073	missense	possibly damaging	0.82
R2907:Otud4	UTSW	8	79673068	missense	probably benign	0.02
R3545:Otud4	UTSW	8	79665055	missense	probably damaging	1.00
R4628:Otud4	UTSW	8	79639968	missense	possibly damaging	0.73
R4790:Otud4	UTSW	8	79666773	missense	possibly damaging	0.82
R4989:Otud4	UTSW	8	79655689	missense	probably damaging	1.00
R5133:Otud4	UTSW	8	79655689	missense	probably damaging	1.00
R5134:Otud4	UTSW	8	79655689	missense	probably damaging	1.00
R5294:Otud4	UTSW	8	79672892	missense	possibly damaging	0.54
R5410:Otud4	UTSW	8	79672997	missense	probably benign	0.04
R5454:Otud4	UTSW	8	79651042	missense	possibly damaging	0.94
R5579:Otud4	UTSW	8	79664108	missense	probably benign
R5738:Otud4	UTSW	8	79673461	missense	probably benign	0.02
R5886:Otud4	UTSW	8	79672807	missense	probably damaging	1.00
R6062:Otud4	UTSW	8	79673896	missense	probably damaging	1.00
R6364:Otud4	UTSW	8	79646341	missense	probably damaging	0.99
R6427:Otud4	UTSW	8	79668497	missense	probably benign	0.00
R6450:Otud4	UTSW	8	79672997	missense	probably benign	0.04
R6744:Otud4	UTSW	8	79673778	nonsense	probably null
R6773:Otud4	UTSW	8	79643806	missense	possibly damaging	0.95
R7046:Otud4	UTSW	8	79651042	missense	possibly damaging	0.94
R7142:Otud4	UTSW	8	79672762	splice site	probably null
R7420:Otud4	UTSW	8	79664108	missense	probably benign	0.11
R7470:Otud4	UTSW	8	79673360	missense	probably benign	0.00
R7670:Otud4	UTSW	8	79655864	splice site	probably null
R7736:Otud4	UTSW	8	79655765	missense	possibly damaging	0.53
R8229:Otud4	UTSW	8	79673975	missense	unknown
R8397:Otud4	UTSW	8	79669298	missense	probably benign	0.06
R9041:Otud4	UTSW	8	79673812	missense	probably damaging	0.98
R9291:Otud4	UTSW	8	79646323	missense	probably damaging	1.00
X0024:Otud4	UTSW	8	79646310	missense	probably benign	0.01
Z1176:Otud4	UTSW	8	79658929	missense	probably benign
Z1177:Otud4	UTSW	8	79643811	nonsense	probably null
Z1177:Otud4	UTSW	8	79643812	missense	probably damaging	0.99
Z1177:Otud4	UTSW	8	79665027	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- GGTTGCTTTGCTAGTAAGAAACTG -3'
(R):5'- TTCATACTGTAAGCCAGCAGC -3'

Sequencing Primer
(F):5'- AGAAACTGATTTGCTGCTTCCTG -3'
(R):5'- CATACTGTAAGCCAGCAGCAATGG -3'

Posted On

2021-01-18