Incidental Mutation 'R8520:Otud4'
ID 658596
Institutional Source Beutler Lab
Gene Symbol Otud4
Ensembl Gene ENSMUSG00000036990
Gene Name OTU domain containing 4
Synonyms 4930431L18Rik, D8Ertd69e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock # R8520 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 79639618-79677724 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79659267 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 256 (N256K)
Ref Sequence ENSEMBL: ENSMUSP00000134097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173078] [ENSMUST00000173286]
AlphaFold B2RRE7
Predicted Effect probably damaging
Transcript: ENSMUST00000173078
AA Change: N256K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133939
Gene: ENSMUSG00000036990
AA Change: N256K

DomainStartEndE-ValueType
Pfam:OTU 40 154 3.4e-17 PFAM
low complexity region 189 213 N/A INTRINSIC
Blast:TUDOR 280 335 2e-7 BLAST
low complexity region 392 405 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 543 555 N/A INTRINSIC
low complexity region 1014 1025 N/A INTRINSIC
low complexity region 1082 1104 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173286
AA Change: N256K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134097
Gene: ENSMUSG00000036990
AA Change: N256K

DomainStartEndE-ValueType
Pfam:OTU 40 149 5.3e-21 PFAM
low complexity region 189 213 N/A INTRINSIC
Blast:TUDOR 280 334 9e-9 BLAST
low complexity region 391 404 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
low complexity region 542 554 N/A INTRINSIC
low complexity region 1013 1024 N/A INTRINSIC
low complexity region 1081 1103 N/A INTRINSIC
Meta Mutation Damage Score 0.6676 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alternatively spliced transcript variants have been found for this gene. The smaller protein isoform encoded by the shorter transcript variant is found only in HIV-1 infected cells. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,609 F136L possibly damaging Het
A430033K04Rik T A 5: 138,646,706 N284K possibly damaging Het
Abcb1a T C 5: 8,685,346 I151T possibly damaging Het
Adam28 C T 14: 68,642,083 G172D probably damaging Het
Adcy6 A G 15: 98,604,160 V191A probably benign Het
Ankrd52 T C 10: 128,389,490 L911P probably damaging Het
C5ar1 A G 7: 16,248,151 S315P probably damaging Het
Cubn A G 2: 13,308,520 probably null Het
Dlec1 T C 9: 119,112,209 S276P probably benign Het
Dnah14 T A 1: 181,653,638 I1564N probably damaging Het
Dsg2 G A 18: 20,579,451 G171R probably damaging Het
Dusp13 C A 14: 21,743,470 G208* probably null Het
Ebf3 A C 7: 137,201,124 probably null Het
Fbn2 A T 18: 58,038,198 probably null Het
Fbxo27 A G 7: 28,693,342 D16G probably benign Het
G6pc3 A G 11: 102,193,108 S187G probably benign Het
Gucy2d G A 7: 98,472,306 V995I probably null Het
Hmcn2 C A 2: 31,354,714 P728T probably damaging Het
Il1r2 T C 1: 40,105,339 L62P probably damaging Het
Ints7 T C 1: 191,582,491 S63P probably damaging Het
Mcf2l C A 8: 12,880,089 D36E probably benign Het
Mfsd13b T G 7: 120,991,363 I109S probably benign Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Mydgf C A 17: 56,183,734 probably null Het
Nanog A T 6: 122,713,516 L268F possibly damaging Het
Olfr305 A T 7: 86,364,263 C25S probably benign Het
Olfr536 T A 7: 140,504,402 D19V probably benign Het
P2rx1 A T 11: 73,008,953 D128V probably benign Het
Pappa G A 4: 65,335,764 V1552I probably benign Het
Pax8 A T 2: 24,443,022 F103I probably damaging Het
Ptk2b T A 14: 66,174,755 S396C probably damaging Het
Rnf148 A G 6: 23,654,170 Y276H probably damaging Het
Sec11c A T 18: 65,814,840 I93L probably damaging Het
Serpinb2 T A 1: 107,523,180 N217K probably benign Het
Slc2a13 T A 15: 91,572,902 T66S probably damaging Het
Slc4a3 T C 1: 75,549,862 M9T probably benign Het
Sord G A 2: 122,256,942 V176I possibly damaging Het
Thbs4 G A 13: 92,754,284 Q892* probably null Het
Thsd7b T A 1: 129,921,420 D956E probably benign Het
Tmem251 T A 12: 102,744,172 probably null Het
Topbp1 T A 9: 103,308,977 probably null Het
Tst T C 15: 78,405,253 E194G probably damaging Het
Ttk T A 9: 83,857,327 S484T possibly damaging Het
U2surp A G 9: 95,502,554 S26P possibly damaging Het
Ugt2b37 C T 5: 87,240,855 A500T probably benign Het
Utrn A T 10: 12,670,186 Y1669* probably null Het
Vmn2r23 A T 6: 123,741,656 Q656L probably damaging Het
Wdr7 A G 18: 63,987,160 N1424S probably benign Het
Xkr9 A G 1: 13,701,379 D373G probably benign Het
Zfp984 T A 4: 147,756,211 Y61F probably benign Het
Other mutations in Otud4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Otud4 APN 8 79672881 missense probably damaging 0.99
IGL01353:Otud4 APN 8 79665021 missense probably benign
IGL01371:Otud4 APN 8 79673761 missense probably damaging 1.00
IGL01782:Otud4 APN 8 79673011 missense possibly damaging 0.95
IGL01912:Otud4 APN 8 79673837 missense probably benign
IGL02294:Otud4 APN 8 79664977 splice site probably benign
IGL02830:Otud4 APN 8 79673301 missense probably benign 0.00
IGL03063:Otud4 APN 8 79663790 missense probably benign 0.01
IGL03077:Otud4 APN 8 79673458 missense probably damaging 0.97
R0437:Otud4 UTSW 8 79669997 missense probably benign 0.02
R1024:Otud4 UTSW 8 79664093 missense probably benign 0.01
R1118:Otud4 UTSW 8 79653351 splice site probably benign
R1296:Otud4 UTSW 8 79673974 missense unknown
R1321:Otud4 UTSW 8 79669950 missense probably benign 0.03
R1674:Otud4 UTSW 8 79673147 missense probably benign 0.12
R1736:Otud4 UTSW 8 79651665 splice site probably benign
R1815:Otud4 UTSW 8 79639989 nonsense probably null
R1950:Otud4 UTSW 8 79646332 missense probably damaging 0.99
R1985:Otud4 UTSW 8 79640012 missense probably damaging 1.00
R2173:Otud4 UTSW 8 79668464 missense probably damaging 1.00
R2869:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2869:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2870:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2870:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2872:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2872:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2907:Otud4 UTSW 8 79673068 missense probably benign 0.02
R3545:Otud4 UTSW 8 79665055 missense probably damaging 1.00
R4628:Otud4 UTSW 8 79639968 missense possibly damaging 0.73
R4790:Otud4 UTSW 8 79666773 missense possibly damaging 0.82
R4989:Otud4 UTSW 8 79655689 missense probably damaging 1.00
R5133:Otud4 UTSW 8 79655689 missense probably damaging 1.00
R5134:Otud4 UTSW 8 79655689 missense probably damaging 1.00
R5294:Otud4 UTSW 8 79672892 missense possibly damaging 0.54
R5410:Otud4 UTSW 8 79672997 missense probably benign 0.04
R5454:Otud4 UTSW 8 79651042 missense possibly damaging 0.94
R5579:Otud4 UTSW 8 79664108 missense probably benign
R5738:Otud4 UTSW 8 79673461 missense probably benign 0.02
R5886:Otud4 UTSW 8 79672807 missense probably damaging 1.00
R6062:Otud4 UTSW 8 79673896 missense probably damaging 1.00
R6364:Otud4 UTSW 8 79646341 missense probably damaging 0.99
R6427:Otud4 UTSW 8 79668497 missense probably benign 0.00
R6450:Otud4 UTSW 8 79672997 missense probably benign 0.04
R6744:Otud4 UTSW 8 79673778 nonsense probably null
R6773:Otud4 UTSW 8 79643806 missense possibly damaging 0.95
R7046:Otud4 UTSW 8 79651042 missense possibly damaging 0.94
R7142:Otud4 UTSW 8 79672762 splice site probably null
R7420:Otud4 UTSW 8 79664108 missense probably benign 0.11
R7470:Otud4 UTSW 8 79673360 missense probably benign 0.00
R7670:Otud4 UTSW 8 79655864 splice site probably null
R7736:Otud4 UTSW 8 79655765 missense possibly damaging 0.53
R8229:Otud4 UTSW 8 79673975 missense unknown
R8397:Otud4 UTSW 8 79669298 missense probably benign 0.06
R9041:Otud4 UTSW 8 79673812 missense probably damaging 0.98
R9291:Otud4 UTSW 8 79646323 missense probably damaging 1.00
X0024:Otud4 UTSW 8 79646310 missense probably benign 0.01
Z1176:Otud4 UTSW 8 79658929 missense probably benign
Z1177:Otud4 UTSW 8 79643811 nonsense probably null
Z1177:Otud4 UTSW 8 79643812 missense probably damaging 0.99
Z1177:Otud4 UTSW 8 79665027 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GGTTGCTTTGCTAGTAAGAAACTG -3'
(R):5'- TTCATACTGTAAGCCAGCAGC -3'

Sequencing Primer
(F):5'- AGAAACTGATTTGCTGCTTCCTG -3'
(R):5'- CATACTGTAAGCCAGCAGCAATGG -3'
Posted On 2021-01-18