Incidental Mutation 'R9010:Bptf'
ID 685583
Institutional Source Beutler Lab
Gene Symbol Bptf
Ensembl Gene ENSMUSG00000040481
Gene Name bromodomain PHD finger transcription factor
Synonyms 9430093H17Rik, Falz
MMRRC Submission
Accession Numbers

Genbank: NM_176850; MGI: 2444008

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9010 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 107033081-107132127 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 107073750 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1539 (D1539E)
Ref Sequence ENSEMBL: ENSMUSP00000102374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057892] [ENSMUST00000106762] [ENSMUST00000106763]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000057892
AA Change: D1424E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000052303
Gene: ENSMUSG00000040481
AA Change: D1424E

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
coiled coil region 864 894 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 987 998 N/A INTRINSIC
low complexity region 1062 1072 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1225 1238 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1491 1503 N/A INTRINSIC
low complexity region 1594 1613 N/A INTRINSIC
low complexity region 1636 1645 N/A INTRINSIC
low complexity region 1665 1683 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
coiled coil region 1908 1936 N/A INTRINSIC
low complexity region 1941 1957 N/A INTRINSIC
low complexity region 2051 2061 N/A INTRINSIC
low complexity region 2092 2107 N/A INTRINSIC
low complexity region 2115 2128 N/A INTRINSIC
low complexity region 2175 2197 N/A INTRINSIC
low complexity region 2227 2252 N/A INTRINSIC
low complexity region 2275 2312 N/A INTRINSIC
low complexity region 2336 2355 N/A INTRINSIC
low complexity region 2361 2378 N/A INTRINSIC
low complexity region 2390 2420 N/A INTRINSIC
low complexity region 2430 2463 N/A INTRINSIC
coiled coil region 2489 2527 N/A INTRINSIC
coiled coil region 2576 2604 N/A INTRINSIC
low complexity region 2663 2700 N/A INTRINSIC
low complexity region 2713 2736 N/A INTRINSIC
PHD 2744 2791 5.32e-9 SMART
BROMO 2800 2908 5.5e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106762
AA Change: D1476E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102373
Gene: ENSMUSG00000040481
AA Change: D1476E

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
internal_repeat_1 589 642 6.48e-5 PROSPERO
low complexity region 644 654 N/A INTRINSIC
low complexity region 662 679 N/A INTRINSIC
coiled coil region 926 956 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1039 1050 N/A INTRINSIC
low complexity region 1114 1124 N/A INTRINSIC
low complexity region 1138 1150 N/A INTRINSIC
low complexity region 1277 1290 N/A INTRINSIC
low complexity region 1303 1317 N/A INTRINSIC
internal_repeat_1 1387 1440 6.48e-5 PROSPERO
low complexity region 1543 1555 N/A INTRINSIC
low complexity region 1646 1665 N/A INTRINSIC
low complexity region 1688 1697 N/A INTRINSIC
low complexity region 1717 1735 N/A INTRINSIC
low complexity region 1870 1886 N/A INTRINSIC
coiled coil region 1960 1988 N/A INTRINSIC
low complexity region 1993 2009 N/A INTRINSIC
low complexity region 2103 2113 N/A INTRINSIC
low complexity region 2144 2159 N/A INTRINSIC
low complexity region 2167 2180 N/A INTRINSIC
low complexity region 2227 2249 N/A INTRINSIC
low complexity region 2279 2304 N/A INTRINSIC
low complexity region 2327 2364 N/A INTRINSIC
low complexity region 2388 2407 N/A INTRINSIC
low complexity region 2413 2430 N/A INTRINSIC
low complexity region 2442 2472 N/A INTRINSIC
low complexity region 2482 2515 N/A INTRINSIC
coiled coil region 2541 2579 N/A INTRINSIC
coiled coil region 2628 2656 N/A INTRINSIC
low complexity region 2715 2752 N/A INTRINSIC
low complexity region 2765 2788 N/A INTRINSIC
PHD 2796 2843 5.32e-9 SMART
BROMO 2852 2960 5.5e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106763
AA Change: D1539E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102374
Gene: ENSMUSG00000040481
AA Change: D1539E

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.9e-8 PFAM
PHD 404 447 2.23e-11 SMART
low complexity region 624 639 N/A INTRINSIC
low complexity region 707 717 N/A INTRINSIC
low complexity region 725 742 N/A INTRINSIC
coiled coil region 989 1019 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1177 1187 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1366 1380 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1709 1728 N/A INTRINSIC
low complexity region 1751 1760 N/A INTRINSIC
low complexity region 1780 1798 N/A INTRINSIC
low complexity region 1933 1949 N/A INTRINSIC
coiled coil region 2023 2051 N/A INTRINSIC
low complexity region 2056 2072 N/A INTRINSIC
low complexity region 2166 2176 N/A INTRINSIC
low complexity region 2207 2222 N/A INTRINSIC
low complexity region 2230 2243 N/A INTRINSIC
low complexity region 2290 2312 N/A INTRINSIC
low complexity region 2342 2367 N/A INTRINSIC
low complexity region 2390 2427 N/A INTRINSIC
low complexity region 2451 2470 N/A INTRINSIC
low complexity region 2476 2493 N/A INTRINSIC
low complexity region 2505 2535 N/A INTRINSIC
low complexity region 2545 2578 N/A INTRINSIC
coiled coil region 2604 2642 N/A INTRINSIC
coiled coil region 2691 2719 N/A INTRINSIC
low complexity region 2778 2815 N/A INTRINSIC
low complexity region 2828 2851 N/A INTRINSIC
PHD 2859 2906 5.32e-9 SMART
BROMO 2915 3023 5.5e-37 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the reactivity of its encoded protein to a monoclonal antibody prepared against brain homogenates from patients with Alzheimer's disease. Analysis of the original protein (fetal Alz-50 reactive clone 1, or FAC1), identified as an 810 aa protein containing a DNA-binding domain and a zinc finger motif, suggested it might play a role in the regulation of transcription. High levels of FAC1 were detected in fetal brain and in patients with neurodegenerative diseases. The protein encoded by this gene is actually much larger than originally thought, and it also contains a C-terminal bromodomain characteristic of proteins that regulate transcription during proliferation. The encoded protein is highly similar to the largest subunit of the Drosophila NURF (nucleosome remodeling factor) complex. In Drosophila, the NURF complex, which catalyzes nucleosome sliding on DNA and interacts with sequence-specific transcription factors, is necessary for the chromatin remodeling required for transcription. Two alternative transcripts encoding different isoforms have been described completely. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with embryonic growth arrest around early gastrulation and a greatly reduced ectoplacental cone. [provided by MGI curators]
Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(56)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 87,971,645 M87K possibly damaging Het
4931406P16Rik A T 7: 34,239,066 C1015S probably benign Het
Akap2 A T 4: 57,883,192 D845V probably damaging Het
Angel1 T C 12: 86,723,379 S36G possibly damaging Het
Apol6 A G 15: 77,051,497 H322R unknown Het
Arfgef2 G A 2: 166,859,364 R694Q probably damaging Het
Bank1 A T 3: 136,055,798 N748K probably benign Het
Bst1 T C 5: 43,825,353 I180T possibly damaging Het
Cabin1 C A 10: 75,735,058 E795* probably null Het
Cckar T A 5: 53,699,821 T416S probably damaging Het
Ccng2 G T 5: 93,268,757 E46* probably null Het
Ceacam9 T C 7: 16,721,991 S8P probably benign Het
Cercam G A 2: 29,876,059 D317N possibly damaging Het
Cfap54 T A 10: 92,899,059 M2377L unknown Het
Cgnl1 A T 9: 71,651,349 L914H probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Clec2g T A 6: 128,948,725 F32L unknown Het
Cntnap5c A T 17: 58,364,164 M1116L probably benign Het
Col11a2 C A 17: 34,064,786 F1516L unknown Het
Crb2 A G 2: 37,790,686 E542G probably benign Het
Crisp1 A T 17: 40,305,210 probably benign Het
Crybg3 G A 16: 59,554,339 T470M probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Eif1ad T A 19: 5,368,698 V93D possibly damaging Het
Entpd3 T C 9: 120,555,759 I134T probably benign Het
Gm19410 A G 8: 35,814,857 M1865V probably benign Het
Gm8251 A G 1: 44,061,473 V155A possibly damaging Het
Gpat2 A G 2: 127,435,226 E728G probably benign Het
Heatr5b C A 17: 78,773,710 S1371I probably damaging Het
Ighv1-4 A T 12: 114,487,329 M53K possibly damaging Het
Itch A T 2: 155,179,071 T169S probably benign Het
Kifc2 A G 15: 76,666,685 N587S possibly damaging Het
Klk1b16 A T 7: 44,140,753 D149V probably benign Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lefty2 T A 1: 180,894,607 I170N probably damaging Het
Lrrc14b A G 13: 74,361,032 F419L possibly damaging Het
Mkrn2 T A 6: 115,614,622 V302E possibly damaging Het
Msh4 T C 3: 153,890,182 K271R probably benign Het
Muc6 T C 7: 141,640,084 T1559A unknown Het
Naa16 T G 14: 79,370,042 R289S probably benign Het
Nab1 T A 1: 52,490,451 I96F possibly damaging Het
Ntn4 T C 10: 93,644,644 C77R Het
Nusap1 A G 2: 119,648,975 T424A possibly damaging Het
Olfr1361 A G 13: 21,658,511 Y271H probably damaging Het
Olfr1509 T A 14: 52,451,099 S229T possibly damaging Het
Olfr59 G T 11: 74,289,479 V278F probably damaging Het
Otog A G 7: 46,300,470 D267G probably benign Het
P2ry2 A C 7: 100,998,151 F316V probably benign Het
Padi2 A G 4: 140,936,613 T426A probably damaging Het
Plxna2 T C 1: 194,788,909 F996S possibly damaging Het
Ppp4r3a T C 12: 101,058,332 M303V possibly damaging Het
Prelid2 A T 18: 41,932,716 W85R probably damaging Het
Rabep1 G A 11: 70,919,208 R532H probably damaging Het
Rabgap1l G A 1: 160,700,873 R388W possibly damaging Het
Rad51ap2 G T 12: 11,458,674 V866L probably benign Het
Rassf3 C A 10: 121,476,086 E9* probably null Het
Rbbp4 A C 4: 129,322,387 L189R probably benign Het
Rims2 T A 15: 39,452,390 C597* probably null Het
Rrp12 T A 19: 41,883,490 I452F probably benign Het
Snx29 G A 16: 11,631,527 A279T probably benign Het
Tdh C T 14: 63,500,255 S17N probably benign Het
Tgm5 T C 2: 121,048,890 D555G possibly damaging Het
Thbs1 A C 2: 118,122,564 D885A probably damaging Het
Tmprss9 C A 10: 80,897,867 A921E unknown Het
Trrap T A 5: 144,846,416 F3340I probably damaging Het
Vmn1r72 A T 7: 11,670,218 M101K possibly damaging Het
Vmn2r117 A G 17: 23,460,471 L593P probably benign Het
Washc2 G A 6: 116,221,862 G295E probably damaging Het
Zfp273 A T 13: 67,826,058 H435L probably damaging Het
Zfp395 A G 14: 65,386,499 E139G possibly damaging Het
Zfp512b G A 2: 181,588,218 A552V possibly damaging Het
Other mutations in Bptf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Bptf APN 11 107055279 missense possibly damaging 0.88
IGL00664:Bptf APN 11 107077665 missense possibly damaging 0.78
IGL00705:Bptf APN 11 107095708 splice site probably benign
IGL00796:Bptf APN 11 107054550 missense probably damaging 1.00
IGL00834:Bptf APN 11 107073928 missense possibly damaging 0.59
IGL01155:Bptf APN 11 107080727 missense probably damaging 1.00
IGL01314:Bptf APN 11 107054853 missense probably damaging 1.00
IGL01371:Bptf APN 11 107055907 missense probably benign 0.00
IGL01567:Bptf APN 11 107058774 missense probably damaging 1.00
IGL01794:Bptf APN 11 107053221 critical splice donor site probably null
IGL02108:Bptf APN 11 107074988 missense probably benign 0.45
IGL02367:Bptf APN 11 107073352 missense probably benign
IGL02437:Bptf APN 11 107074695 missense probably benign 0.00
IGL02589:Bptf APN 11 107111531 missense possibly damaging 0.92
IGL02897:Bptf APN 11 107047121 missense probably damaging 1.00
IGL02935:Bptf APN 11 107080799 missense probably damaging 1.00
IGL02954:Bptf APN 11 107054749 missense possibly damaging 0.89
IGL02982:Bptf APN 11 107076674 missense probably damaging 1.00
IGL03109:Bptf APN 11 107061701 missense possibly damaging 0.53
IGL03265:Bptf APN 11 107054628 missense probably benign 0.00
IGL03403:Bptf APN 11 107099733 missense possibly damaging 0.51
Anodyne UTSW 11 107043631 critical splice donor site probably null
Arroyo UTSW 11 107042690 missense probably benign 0.32
mojado UTSW 11 107044640 missense probably benign 0.03
IGL03097:Bptf UTSW 11 107077680 missense probably damaging 1.00
PIT4486001:Bptf UTSW 11 107054788 missense probably damaging 0.98
R0066:Bptf UTSW 11 107062136 missense possibly damaging 0.90
R0157:Bptf UTSW 11 107074658 missense possibly damaging 0.89
R0320:Bptf UTSW 11 107072819 missense probably damaging 1.00
R0328:Bptf UTSW 11 107047127 missense probably damaging 1.00
R0402:Bptf UTSW 11 107074114 missense probably damaging 1.00
R0482:Bptf UTSW 11 107081262 missense probably benign 0.13
R0574:Bptf UTSW 11 107076527 missense probably damaging 1.00
R0598:Bptf UTSW 11 107072965 missense probably damaging 0.99
R0599:Bptf UTSW 11 107068382 missense probably damaging 1.00
R0601:Bptf UTSW 11 107061692 missense probably benign 0.04
R0744:Bptf UTSW 11 107110812 critical splice donor site probably null
R0836:Bptf UTSW 11 107110812 critical splice donor site probably null
R0885:Bptf UTSW 11 107043791 missense probably damaging 1.00
R1070:Bptf UTSW 11 107055055 missense possibly damaging 0.92
R1252:Bptf UTSW 11 107073251 missense probably benign 0.00
R1370:Bptf UTSW 11 107047094 missense probably damaging 0.99
R1428:Bptf UTSW 11 107073047 missense probably damaging 0.99
R1467:Bptf UTSW 11 107055055 missense possibly damaging 0.92
R1467:Bptf UTSW 11 107055055 missense possibly damaging 0.92
R1742:Bptf UTSW 11 107110951 missense probably damaging 1.00
R1816:Bptf UTSW 11 107060579 missense probably damaging 1.00
R1858:Bptf UTSW 11 107073301 missense probably benign 0.00
R1989:Bptf UTSW 11 107074826 missense probably damaging 1.00
R2253:Bptf UTSW 11 107111322 missense probably damaging 1.00
R2392:Bptf UTSW 11 107072747 missense probably damaging 1.00
R2431:Bptf UTSW 11 107047240 missense possibly damaging 0.48
R3022:Bptf UTSW 11 107111637 critical splice acceptor site probably null
R3161:Bptf UTSW 11 107074476 missense probably damaging 1.00
R3686:Bptf UTSW 11 107074198 missense probably benign 0.25
R3687:Bptf UTSW 11 107074198 missense probably benign 0.25
R3688:Bptf UTSW 11 107074198 missense probably benign 0.25
R3787:Bptf UTSW 11 107073827 missense probably damaging 1.00
R3834:Bptf UTSW 11 107073857 missense probably benign 0.05
R3885:Bptf UTSW 11 107074513 missense probably damaging 0.97
R4090:Bptf UTSW 11 107081523 missense probably damaging 0.99
R4398:Bptf UTSW 11 107110844 missense probably damaging 1.00
R4437:Bptf UTSW 11 107074474 missense possibly damaging 0.59
R4514:Bptf UTSW 11 107077692 missense probably damaging 1.00
R4565:Bptf UTSW 11 107073010 missense probably damaging 1.00
R4715:Bptf UTSW 11 107047181 missense probably damaging 1.00
R4748:Bptf UTSW 11 107095880 missense probably damaging 0.96
R4764:Bptf UTSW 11 107043694 missense probably damaging 1.00
R4885:Bptf UTSW 11 107074648 missense probably benign 0.39
R4901:Bptf UTSW 11 107110860 nonsense probably null
R4995:Bptf UTSW 11 107054565 missense probably damaging 0.98
R5057:Bptf UTSW 11 107082528 missense probably damaging 0.98
R5120:Bptf UTSW 11 107073385 missense probably damaging 0.99
R5320:Bptf UTSW 11 107081367 nonsense probably null
R5329:Bptf UTSW 11 107073295 missense probably benign 0.06
R5418:Bptf UTSW 11 107111294 missense probably damaging 1.00
R5461:Bptf UTSW 11 107061764 missense probably damaging 1.00
R5664:Bptf UTSW 11 107073699 missense probably benign 0.01
R5718:Bptf UTSW 11 107111434 missense probably damaging 1.00
R5774:Bptf UTSW 11 107111137 missense probably damaging 1.00
R5851:Bptf UTSW 11 107110862 missense probably damaging 1.00
R5930:Bptf UTSW 11 107073196 missense probably damaging 1.00
R5949:Bptf UTSW 11 107111089 missense probably damaging 0.99
R5975:Bptf UTSW 11 107035864 utr 3 prime probably benign
R6027:Bptf UTSW 11 107074945 missense probably damaging 1.00
R6128:Bptf UTSW 11 107074690 missense possibly damaging 0.87
R6337:Bptf UTSW 11 107058779 missense possibly damaging 0.89
R6407:Bptf UTSW 11 107111126 missense probably damaging 1.00
R6470:Bptf UTSW 11 107072767 missense probably damaging 1.00
R6487:Bptf UTSW 11 107077726 missense probably damaging 0.99
R6501:Bptf UTSW 11 107077683 missense probably null 1.00
R6755:Bptf UTSW 11 107047256 missense probably benign 0.27
R6861:Bptf UTSW 11 107062565 missense probably damaging 1.00
R6866:Bptf UTSW 11 107073580 missense probably damaging 1.00
R6879:Bptf UTSW 11 107042690 missense probably benign 0.32
R6927:Bptf UTSW 11 107054595 missense probably damaging 1.00
R6944:Bptf UTSW 11 107080823 missense probably damaging 1.00
R7082:Bptf UTSW 11 107086747 missense probably benign 0.00
R7136:Bptf UTSW 11 107099715 missense probably damaging 1.00
R7162:Bptf UTSW 11 107043631 critical splice donor site probably null
R7171:Bptf UTSW 11 107131407 missense unknown
R7193:Bptf UTSW 11 107054809 nonsense probably null
R7210:Bptf UTSW 11 107054464 nonsense probably null
R7221:Bptf UTSW 11 107054832 missense probably damaging 1.00
R7316:Bptf UTSW 11 107073109 missense probably damaging 1.00
R7316:Bptf UTSW 11 107110914 nonsense probably null
R7422:Bptf UTSW 11 107060558 missense probably damaging 1.00
R7454:Bptf UTSW 11 107044640 missense probably benign 0.03
R7657:Bptf UTSW 11 107074729 missense probably damaging 1.00
R7718:Bptf UTSW 11 107081456 missense possibly damaging 0.65
R7827:Bptf UTSW 11 107047187 missense probably benign 0.01
R7844:Bptf UTSW 11 107074061 missense probably damaging 0.97
R7992:Bptf UTSW 11 107110883 missense probably benign 0.00
R8001:Bptf UTSW 11 107047340 nonsense probably null
R8037:Bptf UTSW 11 107055950 missense probably damaging 1.00
R8122:Bptf UTSW 11 107036591 critical splice acceptor site probably null
R8235:Bptf UTSW 11 107076632 missense probably benign 0.04
R8308:Bptf UTSW 11 107052989 missense probably damaging 0.99
R8409:Bptf UTSW 11 107062669 missense probably damaging 1.00
R8464:Bptf UTSW 11 107131342 missense probably benign 0.01
R8477:Bptf UTSW 11 107052853 missense probably damaging 0.98
R8482:Bptf UTSW 11 107043698 missense probably benign 0.19
R8515:Bptf UTSW 11 107055238 missense possibly damaging 0.85
R8519:Bptf UTSW 11 107061764 missense probably damaging 1.00
R8708:Bptf UTSW 11 107073313 missense probably damaging 0.99
R8708:Bptf UTSW 11 107073314 missense probably damaging 1.00
R8722:Bptf UTSW 11 107131469 missense unknown
R8732:Bptf UTSW 11 107040380 missense probably damaging 1.00
R8783:Bptf UTSW 11 107131531 missense unknown
R8828:Bptf UTSW 11 107055010 missense probably damaging 0.98
R9004:Bptf UTSW 11 107054887 missense probably damaging 1.00
R9035:Bptf UTSW 11 107073016 missense probably damaging 1.00
R9083:Bptf UTSW 11 107068350 missense probably damaging 1.00
R9211:Bptf UTSW 11 107055298 missense probably damaging 1.00
R9345:Bptf UTSW 11 107080762 missense possibly damaging 0.77
R9393:Bptf UTSW 11 107074308 missense probably benign 0.00
R9451:Bptf UTSW 11 107044585 missense probably damaging 1.00
R9561:Bptf UTSW 11 107074128 nonsense probably null
R9632:Bptf UTSW 11 107061719 missense probably damaging 1.00
Z1088:Bptf UTSW 11 107074582 missense probably benign 0.00
Z1176:Bptf UTSW 11 107058684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGATGTCACCGTTGATGAAC -3'
(R):5'- GCGTGGAGTCGACAAAATGTC -3'

Sequencing Primer
(F):5'- TTGATGAACGGCTTCGCAGC -3'
(R):5'- TGTCAGGTAGTTTCTAAGTCCAC -3'
Posted On 2021-10-11