Incidental Mutation 'R9010:Kndc1'
ID 685571
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, 2410012C07Rik, very-kind, VKIND
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9010 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 139894696-139941537 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 139927795 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 1222 (S1222F)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
AlphaFold Q0KK55
Predicted Effect possibly damaging
Transcript: ENSMUST00000053445
AA Change: S1222F

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: S1222F

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 87,971,645 M87K possibly damaging Het
4931406P16Rik A T 7: 34,239,066 C1015S probably benign Het
Akap2 A T 4: 57,883,192 D845V probably damaging Het
Angel1 T C 12: 86,723,379 S36G possibly damaging Het
Apol6 A G 15: 77,051,497 H322R unknown Het
Arfgef2 G A 2: 166,859,364 R694Q probably damaging Het
Bank1 A T 3: 136,055,798 N748K probably benign Het
Bptf A T 11: 107,073,750 D1539E probably damaging Het
Bst1 T C 5: 43,825,353 I180T possibly damaging Het
Cabin1 C A 10: 75,735,058 E795* probably null Het
Cckar T A 5: 53,699,821 T416S probably damaging Het
Ccng2 G T 5: 93,268,757 E46* probably null Het
Ceacam9 T C 7: 16,721,991 S8P probably benign Het
Cercam G A 2: 29,876,059 D317N possibly damaging Het
Cfap54 T A 10: 92,899,059 M2377L unknown Het
Cgnl1 A T 9: 71,651,349 L914H probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Clec2g T A 6: 128,948,725 F32L unknown Het
Cntnap5c A T 17: 58,364,164 M1116L probably benign Het
Col11a2 C A 17: 34,064,786 F1516L unknown Het
Crb2 A G 2: 37,790,686 E542G probably benign Het
Crisp1 A T 17: 40,305,210 probably benign Het
Crybg3 G A 16: 59,554,339 T470M probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Eif1ad T A 19: 5,368,698 V93D possibly damaging Het
Entpd3 T C 9: 120,555,759 I134T probably benign Het
Gm19410 A G 8: 35,814,857 M1865V probably benign Het
Gm8251 A G 1: 44,061,473 V155A possibly damaging Het
Gpat2 A G 2: 127,435,226 E728G probably benign Het
Heatr5b C A 17: 78,773,710 S1371I probably damaging Het
Ighv1-4 A T 12: 114,487,329 M53K possibly damaging Het
Itch A T 2: 155,179,071 T169S probably benign Het
Kifc2 A G 15: 76,666,685 N587S possibly damaging Het
Klk1b16 A T 7: 44,140,753 D149V probably benign Het
Lefty2 T A 1: 180,894,607 I170N probably damaging Het
Lrrc14b A G 13: 74,361,032 F419L possibly damaging Het
Mkrn2 T A 6: 115,614,622 V302E possibly damaging Het
Msh4 T C 3: 153,890,182 K271R probably benign Het
Muc6 T C 7: 141,640,084 T1559A unknown Het
Naa16 T G 14: 79,370,042 R289S probably benign Het
Nab1 T A 1: 52,490,451 I96F possibly damaging Het
Ntn4 T C 10: 93,644,644 C77R Het
Nusap1 A G 2: 119,648,975 T424A possibly damaging Het
Olfr1361 A G 13: 21,658,511 Y271H probably damaging Het
Olfr1509 T A 14: 52,451,099 S229T possibly damaging Het
Olfr59 G T 11: 74,289,479 V278F probably damaging Het
Otog A G 7: 46,300,470 D267G probably benign Het
P2ry2 A C 7: 100,998,151 F316V probably benign Het
Padi2 A G 4: 140,936,613 T426A probably damaging Het
Plxna2 T C 1: 194,788,909 F996S possibly damaging Het
Ppp4r3a T C 12: 101,058,332 M303V possibly damaging Het
Prelid2 A T 18: 41,932,716 W85R probably damaging Het
Rabep1 G A 11: 70,919,208 R532H probably damaging Het
Rabgap1l G A 1: 160,700,873 R388W possibly damaging Het
Rad51ap2 G T 12: 11,458,674 V866L probably benign Het
Rassf3 C A 10: 121,476,086 E9* probably null Het
Rbbp4 A C 4: 129,322,387 L189R probably benign Het
Rims2 T A 15: 39,452,390 C597* probably null Het
Rrp12 T A 19: 41,883,490 I452F probably benign Het
Snx29 G A 16: 11,631,527 A279T probably benign Het
Tdh C T 14: 63,500,255 S17N probably benign Het
Tgm5 T C 2: 121,048,890 D555G possibly damaging Het
Thbs1 A C 2: 118,122,564 D885A probably damaging Het
Tmprss9 C A 10: 80,897,867 A921E unknown Het
Trrap T A 5: 144,846,416 F3340I probably damaging Het
Vmn1r72 A T 7: 11,670,218 M101K possibly damaging Het
Vmn2r117 A G 17: 23,460,471 L593P probably benign Het
Washc2 G A 6: 116,221,862 G295E probably damaging Het
Zfp273 A T 13: 67,826,058 H435L probably damaging Het
Zfp395 A G 14: 65,386,499 E139G possibly damaging Het
Zfp512b G A 2: 181,588,218 A552V possibly damaging Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139901988 splice site probably benign
IGL01061:Kndc1 APN 7 139922694 missense probably benign 0.00
IGL01099:Kndc1 APN 7 139920784 missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139913972 splice site probably benign
IGL01767:Kndc1 APN 7 139930046 missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139914194 missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139923790 missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139920767 missense probably benign 0.19
IGL02411:Kndc1 APN 7 139921913 critical splice donor site probably null
IGL02472:Kndc1 APN 7 139910901 missense probably benign 0.01
IGL02537:Kndc1 APN 7 139910410 missense probably benign 0.01
IGL02708:Kndc1 APN 7 139901181 missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139921509 missense probably benign 0.28
IGL03160:Kndc1 APN 7 139920689 nonsense probably null
IGL03138:Kndc1 UTSW 7 139939878 missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139923776 frame shift probably null
PIT4696001:Kndc1 UTSW 7 139932917 missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139910304 missense probably benign 0.00
R0384:Kndc1 UTSW 7 139910599 missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139930124 missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139908996 missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139914023 missense probably null 0.19
R0530:Kndc1 UTSW 7 139901237 missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139923735 missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139922684 missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139927408 missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139930756 missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139927711 missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139921280 missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139930761 missense probably benign 0.02
R2103:Kndc1 UTSW 7 139921234 missense probably benign 0.01
R2128:Kndc1 UTSW 7 139930112 missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139921822 missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139901207 missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139902060 splice site probably benign
R3747:Kndc1 UTSW 7 139927904 critical splice donor site probably null
R3848:Kndc1 UTSW 7 139908977 missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139930028 missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4044:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4095:Kndc1 UTSW 7 139937025 missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139910882 missense probably benign 0.01
R4478:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139910286 missense probably benign 0.00
R4540:Kndc1 UTSW 7 139921427 nonsense probably null
R4584:Kndc1 UTSW 7 139901243 missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139921779 missense probably benign 0.02
R4705:Kndc1 UTSW 7 139930123 missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139924031 nonsense probably null
R4859:Kndc1 UTSW 7 139921905 missense probably benign 0.03
R5004:Kndc1 UTSW 7 139932879 nonsense probably null
R5037:Kndc1 UTSW 7 139910455 missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139936809 missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139908962 missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139931889 missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139927891 missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139924111 missense probably benign 0.00
R5888:Kndc1 UTSW 7 139895217 missense probably benign 0.00
R5942:Kndc1 UTSW 7 139936879 missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139939827 missense probably benign 0.05
R5990:Kndc1 UTSW 7 139927420 missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139923775 frame shift probably null
R6076:Kndc1 UTSW 7 139902038 missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139923802 missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139921213 missense probably benign 0.04
R6276:Kndc1 UTSW 7 139921063 missense probably benign
R6367:Kndc1 UTSW 7 139913506 missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139922751 critical splice donor site probably null
R6745:Kndc1 UTSW 7 139920976 missense probably benign 0.02
R6886:Kndc1 UTSW 7 139913569 missense probably benign 0.01
R6912:Kndc1 UTSW 7 139910278 missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139921828 missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139936836 missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139931860 missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139920783 missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139909043 missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139920696 missense probably benign 0.01
R7570:Kndc1 UTSW 7 139923775 frame shift probably null
R7625:Kndc1 UTSW 7 139938017 missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139895260 missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139939838 missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139923816 missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139920964 missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139921486 missense probably benign 0.02
R8011:Kndc1 UTSW 7 139910620 missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139918844 missense probably benign 0.01
R8134:Kndc1 UTSW 7 139901369 splice site probably null
R8197:Kndc1 UTSW 7 139913531 missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139924045 missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139913518 missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139913518 missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139901205 missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139923753 missense probably benign 0.27
R8735:Kndc1 UTSW 7 139910214 missense probably benign 0.00
R8816:Kndc1 UTSW 7 139937996 missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139924061 missense possibly damaging 0.95
R8961:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9002:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139921441 missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139895224 missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139921476 missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139930118 missense probably benign 0.00
R9510:Kndc1 UTSW 7 139930118 missense probably benign 0.00
R9518:Kndc1 UTSW 7 139939914 missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139920704 missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139921912 missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139910813 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTGGGTCAATAGCAAAGTGAC -3'
(R):5'- TGCATAACCCATGTCAGACAGAG -3'

Sequencing Primer
(F):5'- GTCAATAGCAAAGTGACCCATAG -3'
(R):5'- ATGTCAGACAGAGCTTTCCTTG -3'
Posted On 2021-10-11