Mutagenetix > Incidental Mutation

Incidental Mutation 'R9205:Rpl38'

698466

Institutional Source

Beutler Lab

Gene Symbol

Rpl38

Ensembl Gene

ENSMUSG00000057322

Gene Name

ribosomal protein L38

Synonyms

Ts, Rbt, Tss, 0610025G13Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9205 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114668524-114672331 bp(+) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

T to C at 114672288 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Arginine at position 71 (*71R)

Ref Sequence

ENSEMBL: ENSMUSP00000102211 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045779] [ENSMUST00000077915] [ENSMUST00000082092] [ENSMUST00000106599] [ENSMUST00000106602]

AlphaFold

Q9JJI8

Predicted Effect

probably benign
Transcript: ENSMUST00000045779

SMART Domains

Protein: ENSMUSP00000037821
Gene: ENSMUSG00000034714

Domain	Start	End	E-Value	Type
Pfam:Tweety	27	433	2.5e-184	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000077915
AA Change: *71R

SMART Domains

Protein: ENSMUSP00000102211
Gene: ENSMUSG00000057322
AA Change: *71R

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L38e	2	69	1.6e-36	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000082092
AA Change: *71R

SMART Domains

Protein: ENSMUSP00000080741
Gene: ENSMUSG00000057322
AA Change: *71R

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L38e	2	69	1.6e-36	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000106599
AA Change: *71R

SMART Domains

Protein: ENSMUSP00000102209
Gene: ENSMUSG00000057322
AA Change: *71R

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L38e	2	69	1.6e-36	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000106602
AA Change: *71R

SMART Domains

Protein: ENSMUSP00000102213
Gene: ENSMUSG00000057322
AA Change: *71R

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L38e	2	69	3.9e-40	PFAM

Meta Mutation Damage Score

0.9659

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.3%

Validation Efficiency

95% (76/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L38E family of ribosomal proteins. It is located in the cytoplasm. Alternative splice variants have been identified, both encoding the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome, including one located in the promoter region of the type 1 angiotensin II receptor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene affect growth and tail formation, and result in anterior and posterior homeotic vertebral transformations along the axial skeleton along with other abnormalities depending on genetic background. Homozygotes die in the early embryonic period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aebp2	T	A	6: 140,642,228	H341Q	probably damaging	Het
Apob	G	A	12: 7,980,635	A125T	probably damaging	Het
Bace2	G	T	16: 97,356,859	A20S	unknown	Het
Bcar1	T	C	8: 111,715,709	Y238C	probably damaging	Het
Brinp3	A	T	1: 146,902,089	D758V	possibly damaging	Het
Btnl10	T	C	11: 58,920,519	S223P	probably damaging	Het
Cckar	C	T	5: 53,707,245		probably null	Het
Cdhr2	A	G	13: 54,713,988	N66S	probably benign	Het
Chd9	A	G	8: 91,030,642	M1890V	probably benign	Het
Col6a5	C	T	9: 105,878,638	G2196R	probably damaging	Het
Col9a1	T	G	1: 24,185,094	M119R	unknown	Het
Cryaa	A	G	17: 31,679,668	H123R	probably damaging	Het
Cux1	A	T	5: 136,370,135	D171E	probably damaging	Het
Dgkz	T	A	2: 91,933,799	T1067S	probably benign	Het
Dnah11	C	T	12: 118,027,516	E2372K	probably damaging	Het
Dnah5	T	C	15: 28,448,334	M4181T	possibly damaging	Het
Dnajb14	A	G	3: 137,908,384	E352G	possibly damaging	Het
Dnmt3l	T	A	10: 78,056,752		probably null	Het
Dph6	T	C	2: 114,569,514	I117V	probably damaging	Het
Dsg1a	A	G	18: 20,340,171	D767G	probably damaging	Het
Edn3	C	T	2: 174,761,689	P77S	possibly damaging	Het
Elmsan1	A	C	12: 84,152,887	F1020V	probably benign	Het
Fbln7	A	C	2: 128,895,248	S328R	probably null	Het
Fbn2	T	C	18: 58,059,356	R1518G	probably damaging	Het
Foxi2	A	T	7: 135,411,796	T252S	probably benign	Het
Foxred2	A	G	15: 77,952,006	S384P	probably damaging	Het
Gdpd1	G	A	11: 87,045,183	H174Y	probably benign	Het
Gm10542	A	C	18: 44,204,638	D61A	possibly damaging	Het
Gm10563	TTCCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC	TTCCTCCTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTC	4: 155,635,850		probably benign	Het
H2-Ab1	A	G	17: 34,265,007	E114G	probably damaging	Het
Htt	C	T	5: 34,819,023	T723M	probably benign	Het
Igfn1	C	T	1: 135,975,957	V348I	probably damaging	Het
Itpr1	T	A	6: 108,489,849	L2173Q	probably damaging	Het
Lamp5	A	G	2: 136,059,601	Y115C	probably damaging	Het
Lrp1	T	A	10: 127,594,981	K400*	probably null	Het
Man2a2	C	T	7: 80,361,120	V708I	probably benign	Het
Matr3	T	C	18: 35,587,721	S746P	probably benign	Het
Me1	C	T	9: 86,598,794	V353M	probably benign	Het
Nbeal1	T	A	1: 60,278,680	D1925E	probably damaging	Het
Oca2	T	A	7: 56,316,420	F387I	probably damaging	Het
Olfr1163	T	A	2: 88,070,434	H316L	probably benign	Het
Olfr181	T	G	16: 58,926,122	I150L	probably benign	Het
Olfr181	G	T	16: 58,926,123	F149L	probably benign	Het
Olfr212	T	A	6: 116,516,354	N192K	probably benign	Het
Olfr420	T	C	1: 174,158,890	I39T	probably benign	Het
Olfr912	T	A	9: 38,582,077	S267T	probably benign	Het
Opn3	G	T	1: 175,663,089	N335K	probably benign	Het
Osm	A	G	11: 4,238,504	N44D	possibly damaging	Het
Otop2	T	C	11: 115,329,086	Y251H	probably damaging	Het
Pappa	T	C	4: 65,156,375	S389P	possibly damaging	Het
Polr1d	C	T	5: 147,101,258	A19V	probably damaging	Het
Ptchd4	G	A	17: 42,503,385	V726M	probably benign	Het
Pzp	T	A	6: 128,496,663	D731V	probably benign	Het
Rgl2	A	T	17: 33,936,028	I669F	probably damaging	Het
Rufy1	G	A	11: 50,398,474	R514W	probably damaging	Het
Ruvbl2	G	A	7: 45,434,317		probably benign	Het
Scn9a	T	G	2: 66,533,313	I874L	probably damaging	Het
Slc14a2	A	G	18: 78,195,736	S85P	probably benign	Het
Slc17a1	A	G	13: 23,878,811	I287V	probably benign	Het
Slc35f3	T	A	8: 126,389,189	I285N	probably damaging	Het
Slx4	A	G	16: 3,988,063	S542P	possibly damaging	Het
Sox30	A	T	11: 46,017,353	L782F	probably damaging	Het
Sspo	A	G	6: 48,455,872	N894S	probably benign	Het
Syne1	G	A	10: 5,202,013	Q5765*	probably null	Het
Taar7e	T	C	10: 24,038,074	I154T	probably benign	Het
Tars	A	G	15: 11,397,179		probably null	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,160,856		probably null	Het
Tmem198b	A	T	10: 128,803,188	C29S	probably damaging	Het
Tnr	A	C	1: 159,895,047	M1021L	probably benign	Het
Tom1l1	G	A	11: 90,657,818	P309L	probably damaging	Het
Traf4	A	G	11: 78,161,101	S186P	probably benign	Het
Trpm1	T	G	7: 64,240,571	V974G	possibly damaging	Het
Tsga10	T	A	1: 37,841,278		probably benign	Het
Tyw1	G	A	5: 130,269,224	R202Q	probably damaging	Het
Vmn2r93	A	T	17: 18,304,019	I92F	probably damaging	Het
Zfp457	A	T	13: 67,293,901	D203E	probably benign	Het
Zfp518b	G	A	5: 38,674,158	S168F	probably damaging	Het
Zfp7	TGCGGGAAAGGTTTCCACCTGAGCG	TGCG	15: 76,890,600		probably benign	Het
Zfp777	G	A	6: 48,025,587	T523M	probably benign	Het

Other mutations in Rpl38

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1938:Rpl38	UTSW	11	114671776	missense	probably benign	0.31
R3018:Rpl38	UTSW	11	114668935	missense	possibly damaging	0.69
R6687:Rpl38	UTSW	11	114668768	splice site	probably benign
R8482:Rpl38	UTSW	11	114672288	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- AGAAATGGCTTCCTTGGTCCC -3'
(R):5'- TCCCCAAACGTAGGCTAAAAGG -3'

Sequencing Primer
(F):5'- CCGATTTCTGAGTTAAAGGACAGCC -3'
(R):5'- GAAGGCGATTCAACCACTGAGATC -3'

Posted On

2022-02-07