Incidental Mutation 'R9206:Nrip1'
ID 698550
Institutional Source Beutler Lab
Gene Symbol Nrip1
Ensembl Gene ENSMUSG00000048490
Gene Name nuclear receptor interacting protein 1
Synonyms RIP140, 6030458L20Rik, 8430438I05Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9206 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 76287400-76373827 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76292728 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 647 (E647G)
Ref Sequence ENSEMBL: ENSMUSP00000051726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054178] [ENSMUST00000121927] [ENSMUST00000140483] [ENSMUST00000231585]
AlphaFold Q8CBD1
Predicted Effect possibly damaging
Transcript: ENSMUST00000054178
AA Change: E647G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051726
Gene: ENSMUSG00000048490
AA Change: E647G

DomainStartEndE-ValueType
low complexity region 182 195 N/A INTRINSIC
low complexity region 252 261 N/A INTRINSIC
PDB:2GPP|D 368 392 2e-7 PDB
low complexity region 707 718 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121927
AA Change: E647G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112959
Gene: ENSMUSG00000048490
AA Change: E647G

DomainStartEndE-ValueType
Pfam:NRIP1_repr_1 27 331 5.4e-141 PFAM
PDB:2GPP|D 368 392 2e-7 PDB
Pfam:NRIP1_repr_2 412 739 7.5e-122 PFAM
Pfam:NRIP1_repr_3 754 841 8.4e-45 PFAM
Pfam:NRIP1_repr_4 849 1161 1.7e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140483
Predicted Effect probably benign
Transcript: ENSMUST00000231585
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear receptor interacting protein 1 (NRIP1) is a nuclear protein that specifically interacts with the hormone-dependent activation domain AF2 of nuclear receptors. Also known as RIP140, this protein modulates transcriptional activity of the estrogen receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for targeted disruption of this gene results in female infertility due to ovulation failure. Heterozygous females are partially affected. Male and female mice are smaller than wild-type littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A G 17: 45,509,404 D248G probably benign Het
Abcc5 C A 16: 20,389,389 V605F probably benign Het
AI314180 A T 4: 58,875,444 D173E probably damaging Het
Als2 A G 1: 59,185,247 Y1066H probably damaging Het
Apbb1 A G 7: 105,559,520 S569P probably damaging Het
Apex1 T G 14: 50,925,668 D69E possibly damaging Het
Atg13 A T 2: 91,682,061 F288I probably benign Het
Atl3 A G 19: 7,510,082 I121V probably benign Het
Atoh1 A G 6: 64,729,729 E136G probably benign Het
Ccr7 T C 11: 99,149,069 N9S probably benign Het
Cdhr1 A C 14: 37,080,548 W653G probably damaging Het
Cln6 T A 9: 62,849,183 M203K probably benign Het
Crnn A C 3: 93,146,944 I45L possibly damaging Het
Cse1l C A 2: 166,941,265 N743K probably damaging Het
Cyp1a2 A G 9: 57,682,300 I77T probably damaging Het
D6Wsu163e A G 6: 126,966,969 I443V probably benign Het
Dnah7a G T 1: 53,501,598 T2539N probably benign Het
Fam13c A G 10: 70,553,039 E465G probably damaging Het
Fat4 G C 3: 39,009,241 G4449R probably damaging Het
Fgd5 T C 6: 92,038,210 L964S probably damaging Het
Fpr3 A T 17: 17,970,869 Q134L probably damaging Het
Gm973 A T 1: 59,552,426 Q323L possibly damaging Het
Gna15 A G 10: 81,509,390 S214P probably benign Het
Iars2 A T 1: 185,317,949 M446K possibly damaging Het
Kcnh7 A G 2: 62,777,603 S545P probably damaging Het
Kif1a G T 1: 93,051,480 D928E probably damaging Het
Kif26a C T 12: 112,178,046 T1578M possibly damaging Het
Kif5a A G 10: 127,243,358 probably null Het
Klhl31 T A 9: 77,651,107 Y368* probably null Het
Krtap27-1 A G 16: 88,671,428 V76A possibly damaging Het
Lamc1 A T 1: 153,250,451 H498Q probably damaging Het
Ltbp4 A T 7: 27,322,925 C924S probably damaging Het
Ltn1 T C 16: 87,400,410 D1180G probably benign Het
Macf1 A G 4: 123,684,132 C20R unknown Het
Mpp7 T C 18: 7,403,327 R328G probably benign Het
Ncdn A T 4: 126,750,248 D260E probably benign Het
Nlrp9a C A 7: 26,558,231 L425M possibly damaging Het
Nop9 T A 14: 55,750,135 probably null Het
Nt5c3 C A 6: 56,897,808 M1I probably null Het
Olfr1314 A G 2: 112,092,065 F212S probably benign Het
Olfr69 A G 7: 103,768,271 I42T probably benign Het
Olfr892-ps1 T C 9: 38,189,824 M33T possibly damaging Het
Patj A T 4: 98,539,073 I172F unknown Het
Plxna4 A T 6: 32,517,444 V79D probably damaging Het
Ptprd C G 4: 75,954,078 A1134P possibly damaging Het
Rbm27 T A 18: 42,314,098 Y469* probably null Het
Rbm33 A G 5: 28,352,586 T266A probably damaging Het
Rcbtb2 C T 14: 73,177,060 S437L probably damaging Het
Rcor3 A T 1: 192,101,595 *448R probably null Het
Scn10a T C 9: 119,616,761 Y1442C probably damaging Het
Scn2a A T 2: 65,717,787 I1108F probably damaging Het
Scrn2 T C 11: 97,032,136 I135T probably damaging Het
Sptan1 A T 2: 30,030,712 M2380L possibly damaging Het
Tbc1d12 T C 19: 38,836,998 S98P probably benign Het
Tmem106b A T 6: 13,082,431 T202S probably damaging Het
Tnfsf8 A G 4: 63,834,213 V205A probably benign Het
Tor4a A T 2: 25,194,963 N309K probably damaging Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Tspyl4 A G 10: 34,297,572 H20R probably benign Het
Tvp23b T C 11: 62,882,016 I31T possibly damaging Het
Vmn1r192 A T 13: 22,187,231 F273Y probably damaging Het
Vmn2r6 T A 3: 64,559,611 I156F probably damaging Het
Wnk4 T C 11: 101,274,056 I737T probably damaging Het
Zfp329 A T 7: 12,811,158 D146E probably benign Het
Zfp40 A G 17: 23,175,577 F679L probably damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Zfp804b T C 5: 6,772,154 N303S probably benign Het
Other mutations in Nrip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Nrip1 APN 16 76293703 missense possibly damaging 0.48
IGL00732:Nrip1 APN 16 76293061 missense probably benign 0.31
IGL02024:Nrip1 APN 16 76291675 missense probably benign 0.05
IGL02172:Nrip1 APN 16 76291492 missense probably damaging 0.99
IGL02432:Nrip1 APN 16 76291780 missense probably benign 0.04
IGL03025:Nrip1 APN 16 76294465 missense probably benign 0.06
IGL03410:Nrip1 APN 16 76292491 missense probably benign
PIT4802001:Nrip1 UTSW 16 76293269 missense probably damaging 0.97
R0064:Nrip1 UTSW 16 76294670 utr 5 prime probably benign
R0304:Nrip1 UTSW 16 76292707 missense possibly damaging 0.67
R0320:Nrip1 UTSW 16 76292363 missense probably benign 0.00
R0368:Nrip1 UTSW 16 76294016 missense probably damaging 0.99
R1730:Nrip1 UTSW 16 76292890 missense probably benign 0.42
R1783:Nrip1 UTSW 16 76292890 missense probably benign 0.42
R1850:Nrip1 UTSW 16 76293344 missense probably damaging 1.00
R1900:Nrip1 UTSW 16 76292039 missense probably benign
R2252:Nrip1 UTSW 16 76291285 missense probably damaging 1.00
R3935:Nrip1 UTSW 16 76294435 missense possibly damaging 0.67
R4290:Nrip1 UTSW 16 76291988 missense probably benign 0.00
R4426:Nrip1 UTSW 16 76291405 missense possibly damaging 0.87
R4598:Nrip1 UTSW 16 76293080 missense probably damaging 1.00
R4607:Nrip1 UTSW 16 76293032 missense probably benign 0.00
R4608:Nrip1 UTSW 16 76293032 missense probably benign 0.00
R5893:Nrip1 UTSW 16 76293953 missense probably damaging 1.00
R5939:Nrip1 UTSW 16 76292122 missense probably damaging 0.99
R5966:Nrip1 UTSW 16 76293583 missense possibly damaging 0.47
R6093:Nrip1 UTSW 16 76294764 start gained probably benign
R6154:Nrip1 UTSW 16 76293830 missense probably damaging 1.00
R6639:Nrip1 UTSW 16 76293995 nonsense probably null
R6910:Nrip1 UTSW 16 76294417 missense probably damaging 1.00
R6921:Nrip1 UTSW 16 76292588 missense possibly damaging 0.88
R7314:Nrip1 UTSW 16 76291190 missense probably benign 0.00
R7346:Nrip1 UTSW 16 76293356 missense possibly damaging 0.81
R7386:Nrip1 UTSW 16 76293887 missense probably damaging 1.00
R7485:Nrip1 UTSW 16 76291450 missense probably damaging 1.00
R7506:Nrip1 UTSW 16 76294459 missense probably damaging 1.00
R7517:Nrip1 UTSW 16 76291184 makesense probably null
R7657:Nrip1 UTSW 16 76294699 splice site probably null
R7878:Nrip1 UTSW 16 76294666 start codon destroyed probably null 0.99
R8068:Nrip1 UTSW 16 76292953 missense possibly damaging 0.62
R8254:Nrip1 UTSW 16 76291399 missense probably benign 0.02
R8261:Nrip1 UTSW 16 76292061 missense possibly damaging 0.69
R8294:Nrip1 UTSW 16 76292530 missense probably damaging 1.00
R8723:Nrip1 UTSW 16 76292665 missense probably damaging 0.98
R8739:Nrip1 UTSW 16 76291348 missense possibly damaging 0.51
R8956:Nrip1 UTSW 16 76292305 missense probably benign 0.07
R8988:Nrip1 UTSW 16 76292014 missense probably damaging 1.00
R9024:Nrip1 UTSW 16 76291500 nonsense probably null
R9208:Nrip1 UTSW 16 76292728 missense possibly damaging 0.93
R9393:Nrip1 UTSW 16 76294465 missense probably benign 0.06
R9476:Nrip1 UTSW 16 76292932 missense probably benign 0.26
Z1177:Nrip1 UTSW 16 76293479 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACAGTCCGTCTTTCCAAGAG -3'
(R):5'- ATCAAGTGGAATTCCCCGCC -3'

Sequencing Primer
(F):5'- GATTTTCTATCTCACAACCAGGAAG -3'
(R):5'- AAGTGGAATTCCCCGCCGTATG -3'
Posted On 2022-02-07