Incidental Mutation 'R9482:Hjurp'
ID 716281
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene Name Holliday junction recognition protein
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.908) question?
Stock # R9482 (G1)
Quality Score 217.468
Status Not validated
Chromosome 1
Chromosomal Location 88262471-88277633 bp(-) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) CTCCTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCA to C at 88266274 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127446
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A G 10: 14,431,679 V793A probably benign Het
Als2 G T 1: 59,191,950 P834Q probably damaging Het
Alx1 T C 10: 103,028,474 T45A probably benign Het
Angptl7 T G 4: 148,500,118 S58R possibly damaging Het
Atg3 A G 16: 45,159,118 T7A probably benign Het
Bpifc A T 10: 85,979,254 S283T possibly damaging Het
C2cd2l T A 9: 44,316,617 E231V probably damaging Het
Cdk5r2 T C 1: 74,855,345 V83A probably damaging Het
Chst10 T C 1: 38,868,035 E178G probably damaging Het
Crocc2 T A 1: 93,215,384 L1236Q probably benign Het
Dleu7 T C 14: 62,276,902 *210W probably null Het
Emc1 T G 4: 139,360,890 V323G probably damaging Het
Fcrla T C 1: 170,918,380 T278A probably benign Het
Flrt3 T C 2: 140,661,670 T13A probably benign Het
Galntl6 A T 8: 57,857,515 probably null Het
Gen1 A G 12: 11,255,185 V203A possibly damaging Het
Gm14139 C A 2: 150,192,791 T344K probably benign Het
Gm3149 T A 14: 4,320,208 V169E probably benign Het
Hmcn1 A G 1: 150,734,530 S1463P probably benign Het
Jsrp1 A T 10: 80,808,900 I224N possibly damaging Het
Kcnk2 CAAA CAA 1: 189,256,694 probably null Het
Kcnma1 A T 14: 23,390,965 M591K probably benign Het
Kmt2d A C 15: 98,865,165 W268G probably damaging Het
Knop1 A G 7: 118,848,487 S417P unknown Het
Lpin3 T C 2: 160,904,496 F692L probably damaging Het
Mrvi1 A T 7: 110,946,052 D12E probably benign Het
Mycbp T C 4: 123,910,087 C130R unknown Het
Myh1 T C 11: 67,217,919 I1387T probably damaging Het
Nbeal2 T C 9: 110,633,998 D1333G probably benign Het
Nedd4l G T 18: 64,887,960 probably benign Het
Nucks1 A G 1: 131,919,006 N7D probably benign Het
Nup210 A G 6: 91,042,626 I991T probably damaging Het
Olfr1245 C T 2: 89,575,609 G39D probably damaging Het
Pcdhb3 A G 18: 37,301,683 D234G probably damaging Het
Phyh C T 2: 4,919,052 probably benign Het
Pik3c2a G A 7: 116,362,054 T1070I probably benign Het
Prss52 C T 14: 64,113,680 L305F probably damaging Het
Rasef T C 4: 73,790,696 D100G probably benign Het
Rb1 A C 14: 73,206,053 M754R probably damaging Het
Rbm6 T C 9: 107,792,009 Q568R possibly damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Serf2 C A 2: 121,450,724 D40E possibly damaging Het
Serf2 T C 2: 121,450,725 S41P possibly damaging Het
Sh2b1 AGCTC AGCTCAGCCACGGGGACCCGCTC 7: 126,467,596 probably benign Het
Sympk G T 7: 19,038,061 R350L possibly damaging Het
Tab2 C A 10: 7,919,360 V379L probably damaging Het
Tnk1 T G 11: 69,852,840 T485P probably benign Het
Trmt6 T C 2: 132,806,779 T412A probably benign Het
Vgll3 A G 16: 65,839,343 T182A probably benign Het
Zfat A G 15: 68,212,803 S80P probably damaging Het
Zfyve26 A G 12: 79,244,465 L2122S probably damaging Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88270269 missense probably benign 0.04
IGL03099:Hjurp APN 1 88266289 missense probably benign 0.09
BB003:Hjurp UTSW 1 88266278 utr 3 prime probably benign
IGL03097:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03098:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88266280 utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266046 missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266561 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266616 missense probably benign 0.04
PIT4378001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
PIT4812001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R0053:Hjurp UTSW 1 88277215 splice site probably benign
R0371:Hjurp UTSW 1 88277368 splice site probably benign
R0442:Hjurp UTSW 1 88266524 nonsense probably null
R0762:Hjurp UTSW 1 88277215 splice site probably benign
R0928:Hjurp UTSW 1 88266524 nonsense probably null
R1333:Hjurp UTSW 1 88266046 missense probably damaging 0.98
R1342:Hjurp UTSW 1 88277368 splice site probably benign
R1364:Hjurp UTSW 1 88266525 frame shift probably null
R1496:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88266121 missense probably benign 0.03
R1905:Hjurp UTSW 1 88266616 missense probably benign 0.04
R1965:Hjurp UTSW 1 88266524 nonsense probably null
R1992:Hjurp UTSW 1 88266524 nonsense probably null
R2002:Hjurp UTSW 1 88266524 nonsense probably null
R2023:Hjurp UTSW 1 88266524 nonsense probably null
R2024:Hjurp UTSW 1 88266524 nonsense probably null
R2332:Hjurp UTSW 1 88277215 splice site probably benign
R2420:Hjurp UTSW 1 88266524 nonsense probably null
R2422:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R2869:Hjurp UTSW 1 88266524 nonsense probably null
R2870:Hjurp UTSW 1 88266524 nonsense probably null
R2871:Hjurp UTSW 1 88266524 nonsense probably null
R2872:Hjurp UTSW 1 88266524 nonsense probably null
R3019:Hjurp UTSW 1 88266524 nonsense probably null
R3021:Hjurp UTSW 1 88266524 nonsense probably null
R3150:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R3411:Hjurp UTSW 1 88266524 nonsense probably null
R3552:Hjurp UTSW 1 88266524 nonsense probably null
R3704:Hjurp UTSW 1 88277215 splice site probably benign
R3730:Hjurp UTSW 1 88266524 nonsense probably null
R3733:Hjurp UTSW 1 88266524 nonsense probably null
R3764:Hjurp UTSW 1 88266524 nonsense probably null
R3799:Hjurp UTSW 1 88277215 splice site probably benign
R3819:Hjurp UTSW 1 88277215 splice site probably benign
R3857:Hjurp UTSW 1 88266524 nonsense probably null
R3930:Hjurp UTSW 1 88266524 nonsense probably null
R3952:Hjurp UTSW 1 88277215 splice site probably benign
R4090:Hjurp UTSW 1 88277215 splice site probably benign
R4159:Hjurp UTSW 1 88277215 splice site probably benign
R4207:Hjurp UTSW 1 88277215 splice site probably benign
R4322:Hjurp UTSW 1 88277215 splice site probably benign
R4391:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4392:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4397:Hjurp UTSW 1 88266524 nonsense probably null
R4700:Hjurp UTSW 1 88266524 nonsense probably null
R4808:Hjurp UTSW 1 88277215 splice site probably benign
R4900:Hjurp UTSW 1 88266524 nonsense probably null
R4901:Hjurp UTSW 1 88266524 nonsense probably null
R5023:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88266524 nonsense probably null
R5123:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88266524 nonsense probably null
R5300:Hjurp UTSW 1 88266524 nonsense probably null
R5318:Hjurp UTSW 1 88266524 nonsense probably null
R5370:Hjurp UTSW 1 88266524 nonsense probably null
R5410:Hjurp UTSW 1 88266524 nonsense probably null
R5445:Hjurp UTSW 1 88266316 missense probably benign 0.43
R5457:Hjurp UTSW 1 88266525 frame shift probably null
R5497:Hjurp UTSW 1 88266320 missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88266524 nonsense probably null
R5561:Hjurp UTSW 1 88266524 nonsense probably null
R5615:Hjurp UTSW 1 88266524 nonsense probably null
R5661:Hjurp UTSW 1 88277215 splice site probably benign
R5722:Hjurp UTSW 1 88266524 nonsense probably null
R6087:Hjurp UTSW 1 88266524 nonsense probably null
R6089:Hjurp UTSW 1 88266524 nonsense probably null
R6090:Hjurp UTSW 1 88266524 nonsense probably null
R6125:Hjurp UTSW 1 88266524 nonsense probably null
R6175:Hjurp UTSW 1 88266524 nonsense probably null
R6362:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88266524 nonsense probably null
R7016:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R7016:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R7045:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R7179:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R7200:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R7463:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R7912:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R8215:Hjurp UTSW 1 88266524 nonsense probably null
R8968:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R9038:Hjurp UTSW 1 88266524 nonsense probably null
R9115:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R9133:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R9146:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R9221:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R9475:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R9565:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R9599:Hjurp UTSW 1 88266278 utr 3 prime probably benign
V5622:Hjurp UTSW 1 88277525 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TAAGTCCAAGTCCTTCTGCGG -3'
(R):5'- TTGCAATGTGACAATCAGCG -3'

Sequencing Primer
(F):5'- CTTCTGCGGCATCATCTGGAG -3'
(R):5'- GCAATGTGACAATCAGCGATTTG -3'
Posted On 2022-07-18