Incidental Mutation 'R9492:Cmya5'
ID 717028
Institutional Source Beutler Lab
Gene Symbol Cmya5
Ensembl Gene ENSMUSG00000047419
Gene Name cardiomyopathy associated 5
Synonyms Myospryn, 2310076E16Rik, 2310076E21Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.299) question?
Stock # R9492 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 93177221-93281232 bp(-) (GRCm39)
Type of Mutation makesense
DNA Base Change (assembly) T to C at 93177822 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Stop codon to Tryptophan at position 3677 (*3677W)
Ref Sequence ENSEMBL: ENSMUSP00000050408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062122]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000062122
AA Change: *3677W
SMART Domains Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: *3677W

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
internal_repeat_1 448 535 5.09e-18 PROSPERO
internal_repeat_1 543 625 5.09e-18 PROSPERO
low complexity region 626 645 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 734 741 N/A INTRINSIC
low complexity region 1001 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1259 1267 N/A INTRINSIC
low complexity region 1440 1449 N/A INTRINSIC
low complexity region 1876 1889 N/A INTRINSIC
low complexity region 2632 2645 N/A INTRINSIC
low complexity region 3048 3057 N/A INTRINSIC
FN3 3312 3399 7.29e-4 SMART
FN3 3411 3492 1.3e0 SMART
Pfam:SPRY 3551 3668 6.7e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A C 1: 120,078,472 (GRCm39) K43T probably damaging Het
Abca12 A G 1: 71,297,380 (GRCm39) V2370A possibly damaging Het
Abca13 T A 11: 9,243,667 (GRCm39) C1843* probably null Het
Abr C T 11: 76,399,751 (GRCm39) S82N probably benign Het
Acot2 T C 12: 84,039,384 (GRCm39) S298P probably benign Het
Acrbp A G 6: 125,038,062 (GRCm39) D421G probably benign Het
Adam25 A T 8: 41,206,736 (GRCm39) M1L probably benign Het
Ano8 A G 8: 71,934,784 (GRCm39) V441A possibly damaging Het
Aoc1l1 T C 6: 48,955,540 (GRCm39) S717P probably benign Het
Atg2b T C 12: 105,624,549 (GRCm39) H650R probably benign Het
Atp11a C T 8: 12,894,490 (GRCm39) T695I probably damaging Het
AU018091 A G 7: 3,214,023 (GRCm39) S74P probably benign Het
Cadps2 A G 6: 23,427,238 (GRCm39) Y597H probably benign Het
Ccdc15 C T 9: 37,215,665 (GRCm39) E619K probably damaging Het
Ceacam11 G T 7: 17,709,468 (GRCm39) C222F probably benign Het
Col11a1 G C 3: 114,005,752 (GRCm39) C1628S probably benign Het
Dhx8 T C 11: 101,654,808 (GRCm39) I1032T possibly damaging Het
Dpp10 T C 1: 123,281,159 (GRCm39) D630G probably damaging Het
Eci3 C T 13: 35,143,976 (GRCm39) G50R probably benign Het
Eif2a A G 3: 58,448,475 (GRCm39) T103A probably benign Het
Frem1 T C 4: 82,920,057 (GRCm39) E432G probably damaging Het
Gdnf C T 15: 7,840,423 (GRCm39) probably benign Het
Hace1 T A 10: 45,547,230 (GRCm39) M471K probably benign Het
Hydin A G 8: 111,326,877 (GRCm39) T4739A possibly damaging Het
Ilf2 A G 3: 90,394,570 (GRCm39) I320V probably benign Het
Iqgap3 C A 3: 88,016,176 (GRCm39) F986L probably damaging Het
Klhl21 T C 4: 152,093,419 (GRCm39) L7S probably benign Het
Lrrc61 G T 6: 48,545,761 (GRCm39) E195* probably null Het
Maz G T 7: 126,622,292 (GRCm39) A443E possibly damaging Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Mtor T A 4: 148,568,801 (GRCm39) L1107Q probably damaging Het
Nectin3 T C 16: 46,215,511 (GRCm39) H494R probably benign Het
Nlgn1 G T 3: 25,488,480 (GRCm39) Y618* probably null Het
Nup98 C T 7: 101,778,252 (GRCm39) E1372K probably benign Het
Or12e9 A G 2: 87,201,960 (GRCm39) N28S probably benign Het
Or5af1 T C 11: 58,722,610 (GRCm39) V210A probably benign Het
Otud6b A G 4: 14,818,349 (GRCm39) I184T probably damaging Het
Pcsk6 A G 7: 65,697,346 (GRCm39) N891S probably benign Het
Pde4a T A 9: 21,106,096 (GRCm39) L237Q probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,302,525 (GRCm39) probably benign Het
Pou3f1 A G 4: 124,552,179 (GRCm39) H227R possibly damaging Het
Prss53 G A 7: 127,488,802 (GRCm39) R31C probably damaging Het
Psmb8 T A 17: 34,417,435 (GRCm39) D21E probably benign Het
Ptprq A G 10: 107,478,813 (GRCm39) Y1277H probably damaging Het
Rexo2 T C 9: 48,380,176 (GRCm39) T219A probably benign Het
Rfc3 A G 5: 151,566,411 (GRCm39) F346S probably damaging Het
Rhoq A T 17: 87,304,373 (GRCm39) Q168L Het
Sgk1 A G 10: 21,874,096 (GRCm39) N452S probably damaging Het
Slc35f3 A G 8: 127,048,026 (GRCm39) K122R probably damaging Het
Slc4a2 T A 5: 24,644,761 (GRCm39) M1021K probably benign Het
Sorcs2 A G 5: 36,186,484 (GRCm39) V886A probably benign Het
Spata20 T A 11: 94,374,444 (GRCm39) M308L probably damaging Het
Spen A T 4: 141,199,098 (GRCm39) H3176Q probably benign Het
Stat5b T A 11: 100,692,361 (GRCm39) H141L probably benign Het
Syne2 T A 12: 75,995,839 (GRCm39) H2126Q possibly damaging Het
Traj46 A G 14: 54,409,851 (GRCm39) T20A Het
Trim30a G T 7: 104,078,330 (GRCm39) Q249K probably damaging Het
Trmt13 A G 3: 116,388,281 (GRCm39) Y52H probably benign Het
Trpv3 A G 11: 73,187,267 (GRCm39) I700V probably damaging Het
Tyr G A 7: 87,121,704 (GRCm39) H363Y probably damaging Het
Tyr C G 7: 87,121,705 (GRCm39) M362I possibly damaging Het
Ubb G A 11: 62,442,984 (GRCm39) V5M probably damaging Het
Unc5a T C 13: 55,150,288 (GRCm39) L519P probably damaging Het
Uso1 A G 5: 92,315,191 (GRCm39) D185G possibly damaging Het
Vmn1r228 C T 17: 20,996,862 (GRCm39) E219K probably damaging Het
Wdr49 A G 3: 75,240,669 (GRCm39) V400A probably damaging Het
Zfp292 A G 4: 34,810,794 (GRCm39) M755T probably benign Het
Other mutations in Cmya5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Cmya5 APN 13 93,229,628 (GRCm39) missense probably benign 0.13
IGL00516:Cmya5 APN 13 93,234,675 (GRCm39) missense possibly damaging 0.73
IGL00654:Cmya5 APN 13 93,230,669 (GRCm39) missense probably benign 0.00
IGL00948:Cmya5 APN 13 93,227,544 (GRCm39) missense probably benign
IGL00966:Cmya5 APN 13 93,234,414 (GRCm39) missense probably benign 0.33
IGL00988:Cmya5 APN 13 93,234,441 (GRCm39) missense possibly damaging 0.96
IGL01106:Cmya5 APN 13 93,221,120 (GRCm39) missense probably damaging 1.00
IGL01331:Cmya5 APN 13 93,233,454 (GRCm39) missense possibly damaging 0.53
IGL01392:Cmya5 APN 13 93,225,714 (GRCm39) missense probably damaging 0.99
IGL01508:Cmya5 APN 13 93,230,535 (GRCm39) missense probably benign
IGL01679:Cmya5 APN 13 93,201,828 (GRCm39) missense probably damaging 1.00
IGL01749:Cmya5 APN 13 93,225,807 (GRCm39) missense probably benign 0.00
IGL01861:Cmya5 APN 13 93,226,256 (GRCm39) missense probably damaging 1.00
IGL02021:Cmya5 APN 13 93,231,057 (GRCm39) missense probably benign 0.00
IGL02034:Cmya5 APN 13 93,221,043 (GRCm39) splice site probably benign
IGL02103:Cmya5 APN 13 93,228,635 (GRCm39) missense probably benign 0.05
IGL02174:Cmya5 APN 13 93,185,415 (GRCm39) missense possibly damaging 0.76
IGL02176:Cmya5 APN 13 93,226,658 (GRCm39) missense probably damaging 1.00
IGL02210:Cmya5 APN 13 93,229,242 (GRCm39) missense probably benign 0.14
IGL02229:Cmya5 APN 13 93,229,194 (GRCm39) missense possibly damaging 0.54
IGL02306:Cmya5 APN 13 93,234,527 (GRCm39) missense probably damaging 1.00
IGL02311:Cmya5 APN 13 93,227,163 (GRCm39) missense probably benign 0.40
IGL02409:Cmya5 APN 13 93,226,706 (GRCm39) missense probably damaging 0.96
IGL02561:Cmya5 APN 13 93,228,366 (GRCm39) missense probably benign 0.00
IGL02676:Cmya5 APN 13 93,229,361 (GRCm39) missense probably damaging 1.00
IGL02683:Cmya5 APN 13 93,227,505 (GRCm39) nonsense probably null
IGL02685:Cmya5 APN 13 93,227,505 (GRCm39) nonsense probably null
IGL02686:Cmya5 APN 13 93,227,505 (GRCm39) nonsense probably null
IGL02724:Cmya5 APN 13 93,233,163 (GRCm39) missense probably benign
IGL02727:Cmya5 APN 13 93,234,753 (GRCm39) missense possibly damaging 0.73
IGL02965:Cmya5 APN 13 93,229,065 (GRCm39) missense probably benign 0.41
IGL03079:Cmya5 APN 13 93,234,209 (GRCm39) missense possibly damaging 0.85
IGL03144:Cmya5 APN 13 93,227,376 (GRCm39) missense probably damaging 1.00
IGL03253:Cmya5 APN 13 93,227,778 (GRCm39) nonsense probably null
IGL03336:Cmya5 APN 13 93,230,013 (GRCm39) missense possibly damaging 0.84
IGL03138:Cmya5 UTSW 13 93,201,850 (GRCm39) missense probably damaging 1.00
P0023:Cmya5 UTSW 13 93,225,854 (GRCm39) missense probably benign 0.22
P4748:Cmya5 UTSW 13 93,210,983 (GRCm39) splice site probably benign
R0123:Cmya5 UTSW 13 93,232,412 (GRCm39) missense possibly damaging 0.84
R0206:Cmya5 UTSW 13 93,232,065 (GRCm39) missense probably damaging 0.98
R0206:Cmya5 UTSW 13 93,232,065 (GRCm39) missense probably damaging 0.98
R0242:Cmya5 UTSW 13 93,232,108 (GRCm39) missense probably benign
R0242:Cmya5 UTSW 13 93,232,108 (GRCm39) missense probably benign
R0331:Cmya5 UTSW 13 93,280,911 (GRCm39) missense possibly damaging 0.53
R0363:Cmya5 UTSW 13 93,231,377 (GRCm39) missense possibly damaging 0.77
R0382:Cmya5 UTSW 13 93,229,256 (GRCm39) missense probably benign 0.06
R0416:Cmya5 UTSW 13 93,226,364 (GRCm39) missense probably benign 0.05
R0446:Cmya5 UTSW 13 93,230,164 (GRCm39) missense probably benign
R0457:Cmya5 UTSW 13 93,232,095 (GRCm39) missense possibly damaging 0.84
R0673:Cmya5 UTSW 13 93,226,505 (GRCm39) missense probably damaging 1.00
R0674:Cmya5 UTSW 13 93,229,299 (GRCm39) missense probably damaging 1.00
R0692:Cmya5 UTSW 13 93,230,357 (GRCm39) nonsense probably null
R0698:Cmya5 UTSW 13 93,232,065 (GRCm39) missense probably damaging 0.98
R1227:Cmya5 UTSW 13 93,230,954 (GRCm39) missense probably damaging 0.99
R1272:Cmya5 UTSW 13 93,231,620 (GRCm39) missense possibly damaging 0.79
R1335:Cmya5 UTSW 13 93,178,043 (GRCm39) missense possibly damaging 0.65
R1353:Cmya5 UTSW 13 93,178,033 (GRCm39) missense probably damaging 1.00
R1354:Cmya5 UTSW 13 93,228,566 (GRCm39) missense possibly damaging 0.46
R1458:Cmya5 UTSW 13 93,201,835 (GRCm39) missense probably benign 0.44
R1572:Cmya5 UTSW 13 93,230,777 (GRCm39) missense possibly damaging 0.61
R1698:Cmya5 UTSW 13 93,200,027 (GRCm39) missense probably benign 0.27
R1735:Cmya5 UTSW 13 93,226,297 (GRCm39) missense probably benign 0.11
R1743:Cmya5 UTSW 13 93,233,825 (GRCm39) missense probably benign 0.33
R1750:Cmya5 UTSW 13 93,232,171 (GRCm39) missense probably benign
R1827:Cmya5 UTSW 13 93,210,956 (GRCm39) missense possibly damaging 0.80
R2068:Cmya5 UTSW 13 93,227,032 (GRCm39) missense possibly damaging 0.93
R2088:Cmya5 UTSW 13 93,229,320 (GRCm39) missense probably damaging 1.00
R2132:Cmya5 UTSW 13 93,205,891 (GRCm39) missense probably damaging 1.00
R2216:Cmya5 UTSW 13 93,230,003 (GRCm39) missense probably damaging 1.00
R2363:Cmya5 UTSW 13 93,230,210 (GRCm39) missense probably benign 0.15
R2497:Cmya5 UTSW 13 93,234,513 (GRCm39) missense possibly damaging 0.53
R2509:Cmya5 UTSW 13 93,230,066 (GRCm39) missense probably benign 0.41
R2917:Cmya5 UTSW 13 93,227,572 (GRCm39) nonsense probably null
R2944:Cmya5 UTSW 13 93,229,350 (GRCm39) nonsense probably null
R3039:Cmya5 UTSW 13 93,228,758 (GRCm39) missense probably benign 0.12
R3078:Cmya5 UTSW 13 93,185,435 (GRCm39) missense probably damaging 0.99
R3708:Cmya5 UTSW 13 93,231,874 (GRCm39) nonsense probably null
R3717:Cmya5 UTSW 13 93,228,995 (GRCm39) missense probably benign 0.12
R3768:Cmya5 UTSW 13 93,233,201 (GRCm39) missense possibly damaging 0.73
R3769:Cmya5 UTSW 13 93,233,201 (GRCm39) missense possibly damaging 0.73
R3840:Cmya5 UTSW 13 93,231,140 (GRCm39) missense probably damaging 0.96
R3841:Cmya5 UTSW 13 93,231,140 (GRCm39) missense probably damaging 0.96
R3882:Cmya5 UTSW 13 93,227,727 (GRCm39) missense probably benign 0.07
R3888:Cmya5 UTSW 13 93,230,164 (GRCm39) missense probably benign
R3897:Cmya5 UTSW 13 93,233,189 (GRCm39) missense possibly damaging 0.72
R3952:Cmya5 UTSW 13 93,225,707 (GRCm39) missense possibly damaging 0.89
R4366:Cmya5 UTSW 13 93,228,464 (GRCm39) missense probably benign 0.36
R4471:Cmya5 UTSW 13 93,228,833 (GRCm39) missense probably benign 0.01
R4493:Cmya5 UTSW 13 93,230,573 (GRCm39) missense probably benign
R4495:Cmya5 UTSW 13 93,230,573 (GRCm39) missense probably benign
R4544:Cmya5 UTSW 13 93,228,426 (GRCm39) nonsense probably null
R4545:Cmya5 UTSW 13 93,228,426 (GRCm39) nonsense probably null
R4624:Cmya5 UTSW 13 93,200,059 (GRCm39) missense probably damaging 1.00
R4648:Cmya5 UTSW 13 93,230,336 (GRCm39) missense possibly damaging 0.84
R4824:Cmya5 UTSW 13 93,230,082 (GRCm39) missense probably benign 0.04
R4965:Cmya5 UTSW 13 93,232,295 (GRCm39) missense possibly damaging 0.84
R4967:Cmya5 UTSW 13 93,227,093 (GRCm39) missense probably damaging 1.00
R5101:Cmya5 UTSW 13 93,228,111 (GRCm39) missense possibly damaging 0.61
R5133:Cmya5 UTSW 13 93,229,880 (GRCm39) missense possibly damaging 0.79
R5139:Cmya5 UTSW 13 93,232,569 (GRCm39) missense probably benign 0.00
R5220:Cmya5 UTSW 13 93,228,804 (GRCm39) missense probably damaging 0.99
R5332:Cmya5 UTSW 13 93,232,703 (GRCm39) missense probably damaging 0.96
R5337:Cmya5 UTSW 13 93,219,781 (GRCm39) missense probably benign 0.28
R5356:Cmya5 UTSW 13 93,199,993 (GRCm39) missense probably damaging 1.00
R5401:Cmya5 UTSW 13 93,228,476 (GRCm39) missense probably damaging 1.00
R5438:Cmya5 UTSW 13 93,231,707 (GRCm39) missense possibly damaging 0.89
R5604:Cmya5 UTSW 13 93,229,271 (GRCm39) missense probably benign 0.15
R5628:Cmya5 UTSW 13 93,226,218 (GRCm39) missense probably damaging 1.00
R5666:Cmya5 UTSW 13 93,182,457 (GRCm39) missense possibly damaging 0.75
R5687:Cmya5 UTSW 13 93,234,684 (GRCm39) missense possibly damaging 0.53
R5695:Cmya5 UTSW 13 93,182,374 (GRCm39) critical splice donor site probably null
R5806:Cmya5 UTSW 13 93,230,445 (GRCm39) missense possibly damaging 0.84
R5820:Cmya5 UTSW 13 93,229,288 (GRCm39) missense probably benign 0.04
R5872:Cmya5 UTSW 13 93,233,943 (GRCm39) missense probably benign 0.01
R5875:Cmya5 UTSW 13 93,231,692 (GRCm39) missense probably benign 0.13
R5896:Cmya5 UTSW 13 93,182,373 (GRCm39) critical splice donor site probably null
R5910:Cmya5 UTSW 13 93,229,151 (GRCm39) missense probably damaging 0.98
R5969:Cmya5 UTSW 13 93,226,052 (GRCm39) missense possibly damaging 0.78
R6064:Cmya5 UTSW 13 93,226,157 (GRCm39) missense probably damaging 1.00
R6081:Cmya5 UTSW 13 93,281,021 (GRCm39) unclassified probably benign
R6102:Cmya5 UTSW 13 93,230,739 (GRCm39) missense probably benign
R6117:Cmya5 UTSW 13 93,231,674 (GRCm39) missense probably damaging 0.98
R6188:Cmya5 UTSW 13 93,233,784 (GRCm39) missense possibly damaging 0.73
R6188:Cmya5 UTSW 13 93,229,952 (GRCm39) missense possibly damaging 0.61
R6219:Cmya5 UTSW 13 93,230,951 (GRCm39) missense probably damaging 1.00
R6229:Cmya5 UTSW 13 93,229,814 (GRCm39) missense probably benign 0.41
R6346:Cmya5 UTSW 13 93,228,698 (GRCm39) missense probably damaging 1.00
R6431:Cmya5 UTSW 13 93,210,972 (GRCm39) missense possibly damaging 0.60
R6436:Cmya5 UTSW 13 93,225,723 (GRCm39) missense probably damaging 0.98
R6598:Cmya5 UTSW 13 93,226,316 (GRCm39) missense probably benign 0.05
R6649:Cmya5 UTSW 13 93,234,533 (GRCm39) missense possibly damaging 0.91
R6652:Cmya5 UTSW 13 93,229,547 (GRCm39) missense probably damaging 0.99
R6652:Cmya5 UTSW 13 93,229,403 (GRCm39) missense probably benign 0.04
R6669:Cmya5 UTSW 13 93,229,767 (GRCm39) missense probably benign 0.03
R6881:Cmya5 UTSW 13 93,226,800 (GRCm39) missense probably damaging 1.00
R6909:Cmya5 UTSW 13 93,227,760 (GRCm39) missense probably benign 0.04
R6933:Cmya5 UTSW 13 93,231,644 (GRCm39) missense probably benign 0.03
R7021:Cmya5 UTSW 13 93,230,063 (GRCm39) missense possibly damaging 0.62
R7022:Cmya5 UTSW 13 93,205,786 (GRCm39) critical splice donor site probably null
R7068:Cmya5 UTSW 13 93,229,205 (GRCm39) missense possibly damaging 0.59
R7087:Cmya5 UTSW 13 93,227,483 (GRCm39) missense probably benign 0.00
R7088:Cmya5 UTSW 13 93,228,372 (GRCm39) missense possibly damaging 0.95
R7126:Cmya5 UTSW 13 93,226,448 (GRCm39) missense probably benign 0.41
R7177:Cmya5 UTSW 13 93,231,836 (GRCm39) missense probably benign 0.00
R7188:Cmya5 UTSW 13 93,182,546 (GRCm39) missense probably damaging 1.00
R7217:Cmya5 UTSW 13 93,226,938 (GRCm39) missense probably damaging 1.00
R7278:Cmya5 UTSW 13 93,232,208 (GRCm39) missense probably damaging 0.96
R7293:Cmya5 UTSW 13 93,229,305 (GRCm39) missense possibly damaging 0.90
R7332:Cmya5 UTSW 13 93,229,061 (GRCm39) missense possibly damaging 0.60
R7375:Cmya5 UTSW 13 93,228,169 (GRCm39) missense probably damaging 0.97
R7386:Cmya5 UTSW 13 93,205,831 (GRCm39) missense probably damaging 1.00
R7489:Cmya5 UTSW 13 93,228,346 (GRCm39) missense possibly damaging 0.87
R7529:Cmya5 UTSW 13 93,233,942 (GRCm39) missense probably benign 0.02
R7552:Cmya5 UTSW 13 93,205,820 (GRCm39) missense probably benign 0.41
R7624:Cmya5 UTSW 13 93,226,865 (GRCm39) missense possibly damaging 0.79
R7637:Cmya5 UTSW 13 93,219,720 (GRCm39) missense possibly damaging 0.87
R7673:Cmya5 UTSW 13 93,230,629 (GRCm39) missense probably benign 0.13
R7753:Cmya5 UTSW 13 93,234,680 (GRCm39) missense probably benign 0.18
R7757:Cmya5 UTSW 13 93,234,780 (GRCm39) missense possibly damaging 0.53
R7806:Cmya5 UTSW 13 93,230,770 (GRCm39) missense probably benign 0.00
R7825:Cmya5 UTSW 13 93,234,136 (GRCm39) missense possibly damaging 0.53
R7878:Cmya5 UTSW 13 93,226,265 (GRCm39) missense probably damaging 0.98
R7892:Cmya5 UTSW 13 93,232,865 (GRCm39) missense probably damaging 0.96
R7952:Cmya5 UTSW 13 93,233,512 (GRCm39) small deletion probably benign
R8127:Cmya5 UTSW 13 93,231,122 (GRCm39) missense probably damaging 0.99
R8256:Cmya5 UTSW 13 93,229,986 (GRCm39) missense possibly damaging 0.62
R8339:Cmya5 UTSW 13 93,228,142 (GRCm39) nonsense probably null
R8446:Cmya5 UTSW 13 93,230,336 (GRCm39) missense possibly damaging 0.84
R8553:Cmya5 UTSW 13 93,230,304 (GRCm39) missense probably benign 0.00
R8686:Cmya5 UTSW 13 93,231,888 (GRCm39) missense possibly damaging 0.91
R8748:Cmya5 UTSW 13 93,226,229 (GRCm39) missense probably damaging 1.00
R8783:Cmya5 UTSW 13 93,225,888 (GRCm39) missense possibly damaging 0.58
R8803:Cmya5 UTSW 13 93,177,991 (GRCm39) missense probably damaging 1.00
R8810:Cmya5 UTSW 13 93,200,048 (GRCm39) missense possibly damaging 0.47
R8937:Cmya5 UTSW 13 93,232,840 (GRCm39) missense probably benign 0.01
R8985:Cmya5 UTSW 13 93,233,664 (GRCm39) missense possibly damaging 0.73
R9017:Cmya5 UTSW 13 93,228,572 (GRCm39) missense probably benign 0.03
R9087:Cmya5 UTSW 13 93,233,711 (GRCm39) missense possibly damaging 0.72
R9133:Cmya5 UTSW 13 93,234,108 (GRCm39) missense possibly damaging 0.73
R9156:Cmya5 UTSW 13 93,233,878 (GRCm39) missense unknown
R9209:Cmya5 UTSW 13 93,226,866 (GRCm39) missense probably benign 0.45
R9222:Cmya5 UTSW 13 93,230,579 (GRCm39) missense probably benign 0.00
R9229:Cmya5 UTSW 13 93,232,176 (GRCm39) missense possibly damaging 0.92
R9382:Cmya5 UTSW 13 93,229,884 (GRCm39) missense probably benign
R9385:Cmya5 UTSW 13 93,230,880 (GRCm39) missense probably damaging 0.99
R9418:Cmya5 UTSW 13 93,226,209 (GRCm39) missense probably benign 0.22
R9452:Cmya5 UTSW 13 93,232,394 (GRCm39) missense probably benign
R9600:Cmya5 UTSW 13 93,226,604 (GRCm39) missense probably damaging 1.00
R9712:Cmya5 UTSW 13 93,201,881 (GRCm39) critical splice acceptor site probably null
R9742:Cmya5 UTSW 13 93,231,935 (GRCm39) missense possibly damaging 0.89
RF020:Cmya5 UTSW 13 93,205,799 (GRCm39) missense possibly damaging 0.56
X0028:Cmya5 UTSW 13 93,233,195 (GRCm39) missense possibly damaging 0.53
Z1088:Cmya5 UTSW 13 93,200,087 (GRCm39) missense probably benign
Z1176:Cmya5 UTSW 13 93,233,298 (GRCm39) missense unknown
Z1176:Cmya5 UTSW 13 93,200,087 (GRCm39) missense probably benign
Z1177:Cmya5 UTSW 13 93,200,087 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCAACTGTGAACCAAGGGTG -3'
(R):5'- TGGACTATACCAACCAGAGACTTC -3'

Sequencing Primer
(F):5'- AAGGCTGTGTTTCCGCC -3'
(R):5'- CTGTTTATAAACGCCGAGAGTG -3'
Posted On 2022-07-18