Incidental Mutation 'R9537:Osgep'
ID 719753
Institutional Source Beutler Lab
Gene Symbol Osgep
Ensembl Gene ENSMUSG00000006289
Gene Name O-sialoglycoprotein endopeptidase
Synonyms GCPL-1, 1500019L24Rik, PRSMG1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock # R9537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 50906478-50924893 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 50924662 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006452] [ENSMUST00000049312] [ENSMUST00000049411] [ENSMUST00000128395] [ENSMUST00000136753] [ENSMUST00000154288] [ENSMUST00000159292] [ENSMUST00000160375] [ENSMUST00000160393] [ENSMUST00000160538] [ENSMUST00000160835] [ENSMUST00000160890] [ENSMUST00000161166] [ENSMUST00000162177] [ENSMUST00000162957]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006452
SMART Domains Protein: ENSMUSP00000006452
Gene: ENSMUSG00000006289

DomainStartEndE-ValueType
Pfam:Peptidase_M22 23 186 1.1e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049312
SMART Domains Protein: ENSMUSP00000038276
Gene: ENSMUSG00000035953

DomainStartEndE-ValueType
Pfam:Tmemb_55A 1 270 9.8e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049411
SMART Domains Protein: ENSMUSP00000042602
Gene: ENSMUSG00000035960

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
Pfam:Exo_endo_phos 64 308 1.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128395
SMART Domains Protein: ENSMUSP00000116319
Gene: ENSMUSG00000035960

DomainStartEndE-ValueType
low complexity region 9 35 N/A INTRINSIC
Pfam:Exo_endo_phos 59 280 2.3e-24 PFAM
Pfam:Exo_endo_phos_2 138 284 4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136753
SMART Domains Protein: ENSMUSP00000123148
Gene: ENSMUSG00000035960

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
Pfam:Exo_endo_phos 64 177 3.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154288
SMART Domains Protein: ENSMUSP00000122343
Gene: ENSMUSG00000035960

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
Pfam:Exo_endo_phos 64 214 1.1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159292
SMART Domains Protein: ENSMUSP00000124039
Gene: ENSMUSG00000006289

DomainStartEndE-ValueType
Pfam:Peptidase_M22 23 301 3.6e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160375
SMART Domains Protein: ENSMUSP00000124099
Gene: ENSMUSG00000006289

DomainStartEndE-ValueType
Pfam:Peptidase_M22 1 156 1.3e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160393
SMART Domains Protein: ENSMUSP00000125155
Gene: ENSMUSG00000006289

DomainStartEndE-ValueType
Pfam:Peptidase_M22 23 301 3.6e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160538
SMART Domains Protein: ENSMUSP00000124259
Gene: ENSMUSG00000035953

DomainStartEndE-ValueType
Pfam:Tmemb_55A 1 197 1.9e-82 PFAM
low complexity region 221 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160835
SMART Domains Protein: ENSMUSP00000124782
Gene: ENSMUSG00000035953

DomainStartEndE-ValueType
Pfam:Tmemb_55A 4 277 2.8e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160890
SMART Domains Protein: ENSMUSP00000124659
Gene: ENSMUSG00000006289

DomainStartEndE-ValueType
Pfam:Peptidase_M22 23 79 1.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161166
SMART Domains Protein: ENSMUSP00000125414
Gene: ENSMUSG00000035953

DomainStartEndE-ValueType
Pfam:Tmemb_55A 1 168 3.6e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161669
Predicted Effect probably benign
Transcript: ENSMUST00000162177
SMART Domains Protein: ENSMUSP00000124016
Gene: ENSMUSG00000006289

DomainStartEndE-ValueType
Pfam:Peptidase_M22 1 220 1.1e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162957
SMART Domains Protein: ENSMUSP00000123697
Gene: ENSMUSG00000035953

DomainStartEndE-ValueType
Pfam:Tmemb_55A 1 174 2.9e-64 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,153,162 K341E possibly damaging Het
Adgra3 A G 5: 49,960,865 Y1114H possibly damaging Het
Atp5j A G 16: 84,828,470 Y82H probably damaging Het
Bcl2a1d T G 9: 88,731,473 I83L probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Bglap3 T C 3: 88,368,832 D71G probably benign Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Chmp2b T C 16: 65,551,046 K15E probably benign Het
Chrm3 A T 13: 9,877,426 W525R probably damaging Het
Col7a1 A T 9: 108,955,352 K143* probably null Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Dnaic1 A G 4: 41,629,790 probably null Het
Dnhd1 G A 7: 105,695,533 G2028D probably damaging Het
Esyt3 C T 9: 99,317,239 R773Q probably damaging Het
Ffar1 T C 7: 30,860,600 T291A probably benign Het
Gm5767 G T 16: 8,683,313 C11F Het
Golga2 G T 2: 32,288,301 probably benign Het
Hapln2 T A 3: 88,024,473 probably null Het
Ing1 T C 8: 11,561,889 L203P probably benign Het
Med1 T C 11: 98,171,760 T171A possibly damaging Het
Mib2 A T 4: 155,657,495 L387H probably damaging Het
Mier1 A G 4: 103,162,561 N494S probably benign Het
Myof A G 19: 37,907,606 L1847P probably damaging Het
Ndst3 A T 3: 123,671,513 V270D Het
Nup160 T C 2: 90,729,744 L1271S possibly damaging Het
Ptgfr G T 3: 151,835,808 T21N possibly damaging Het
Ptgs1 T C 2: 36,230,727 S23P unknown Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Smu1 A G 4: 40,755,671 S65P probably benign Het
Spef2 T C 15: 9,601,799 Y1459C unknown Het
Spen A G 4: 141,471,704 V3204A probably benign Het
Spen TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 4: 141,516,845 probably benign Het
Timm44 G A 8: 4,260,576 T392I possibly damaging Het
Tnc A T 4: 63,966,584 I1818N probably damaging Het
Trpm1 G T 7: 64,153,868 probably benign Het
Ttc14 A G 3: 33,803,198 Y231C probably damaging Het
Ube3b A G 5: 114,387,184 R23G probably damaging Het
Usp40 T C 1: 88,007,395 Y10C probably benign Het
Vmn2r107 C A 17: 20,374,887 S567R probably benign Het
Zfp112 T C 7: 24,127,087 Y831H probably damaging Het
Zfy2 T A Y: 2,108,596 T355S Het
Other mutations in Osgep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Osgep APN 14 50916162 missense probably benign 0.21
IGL02366:Osgep APN 14 50919950 missense probably damaging 0.98
IGL02800:Osgep APN 14 50915857 utr 3 prime probably benign
IGL03258:Osgep APN 14 50917889 missense possibly damaging 0.65
R3104:Osgep UTSW 14 50916829 missense probably benign 0.03
R3105:Osgep UTSW 14 50916829 missense probably benign 0.03
R3106:Osgep UTSW 14 50916829 missense probably benign 0.03
R3899:Osgep UTSW 14 50924743 missense probably damaging 1.00
R4608:Osgep UTSW 14 50917921 missense probably damaging 1.00
R5152:Osgep UTSW 14 50917858 missense probably damaging 0.99
R6169:Osgep UTSW 14 50919752 missense possibly damaging 0.88
R7009:Osgep UTSW 14 50924708 missense probably damaging 0.98
R7873:Osgep UTSW 14 50915890 missense probably damaging 0.99
R8054:Osgep UTSW 14 50924671 unclassified probably benign
R8477:Osgep UTSW 14 50917877 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCGGAACACATATTTTCGG -3'
(R):5'- AAAGTCCCTTCGCTTGGTTC -3'

Sequencing Primer
(F):5'- GCCTTTAATTCCAGCAGTCAAGAGTC -3'
(R):5'- CCTTCGCTTGGTTCTGGGTTG -3'
Posted On 2022-07-18