Incidental Mutation 'R9537:Adgra3'
ID 719737
Institutional Source Beutler Lab
Gene Symbol Adgra3
Ensembl Gene ENSMUSG00000029090
Gene Name adhesion G protein-coupled receptor A3
Synonyms Gpr125, Tem5-like, 3830613O22Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9537 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 49959956-50059006 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49960865 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1114 (Y1114H)
Ref Sequence ENSEMBL: ENSMUSP00000030971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030971]
AlphaFold Q7TT36
Predicted Effect possibly damaging
Transcript: ENSMUST00000030971
AA Change: Y1114H

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030971
Gene: ENSMUSG00000029090
AA Change: Y1114H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 36 48 N/A INTRINSIC
LRR 68 92 1.71e1 SMART
LRR_TYP 93 116 2.27e-4 SMART
LRR_TYP 117 140 4.11e-2 SMART
LRR_TYP 141 164 3.89e-3 SMART
LRRCT 176 225 5.24e-5 SMART
IG 238 331 8.26e-5 SMART
GPS 686 738 4.81e-3 SMART
Pfam:7tm_2 746 1031 1.6e-16 PFAM
low complexity region 1251 1262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor superfamily. This membrane protein may play a role in tumor angiogenesis through its interaction with the human homolog of the Drosophila disc large tumor suppressor gene. This gene is mapped to a candidate region of chromosome 4 which may be associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous mutant mice are fertile and grossly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,153,162 K341E possibly damaging Het
Atp5j A G 16: 84,828,470 Y82H probably damaging Het
Bcl2a1d T G 9: 88,731,473 I83L probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Bglap3 T C 3: 88,368,832 D71G probably benign Het
Bnip3l G A 14: 67,008,765 P7L possibly damaging Het
Chmp2b T C 16: 65,551,046 K15E probably benign Het
Chrm3 A T 13: 9,877,426 W525R probably damaging Het
Col7a1 A T 9: 108,955,352 K143* probably null Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Dnaic1 A G 4: 41,629,790 probably null Het
Dnhd1 G A 7: 105,695,533 G2028D probably damaging Het
Esyt3 C T 9: 99,317,239 R773Q probably damaging Het
Ffar1 T C 7: 30,860,600 T291A probably benign Het
Gm5767 G T 16: 8,683,313 C11F Het
Golga2 G T 2: 32,288,301 probably benign Het
Hapln2 T A 3: 88,024,473 probably null Het
Ing1 T C 8: 11,561,889 L203P probably benign Het
Med1 T C 11: 98,171,760 T171A possibly damaging Het
Mib2 A T 4: 155,657,495 L387H probably damaging Het
Mier1 A G 4: 103,162,561 N494S probably benign Het
Myof A G 19: 37,907,606 L1847P probably damaging Het
Ndst3 A T 3: 123,671,513 V270D Het
Nup160 T C 2: 90,729,744 L1271S possibly damaging Het
Osgep A T 14: 50,924,662 probably null Het
Ptgfr G T 3: 151,835,808 T21N possibly damaging Het
Ptgs1 T C 2: 36,230,727 S23P unknown Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Smu1 A G 4: 40,755,671 S65P probably benign Het
Spef2 T C 15: 9,601,799 Y1459C unknown Het
Spen A G 4: 141,471,704 V3204A probably benign Het
Spen TTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTG 4: 141,516,845 probably benign Het
Timm44 G A 8: 4,260,576 T392I possibly damaging Het
Tnc A T 4: 63,966,584 I1818N probably damaging Het
Trpm1 G T 7: 64,153,868 probably benign Het
Ttc14 A G 3: 33,803,198 Y231C probably damaging Het
Ube3b A G 5: 114,387,184 R23G probably damaging Het
Usp40 T C 1: 88,007,395 Y10C probably benign Het
Vmn2r107 C A 17: 20,374,887 S567R probably benign Het
Zfp112 T C 7: 24,127,087 Y831H probably damaging Het
Zfy2 T A Y: 2,108,596 T355S Het
Other mutations in Adgra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Adgra3 APN 5 50025758 missense probably damaging 1.00
IGL00848:Adgra3 APN 5 50001949 missense probably damaging 1.00
IGL01455:Adgra3 APN 5 49987557 nonsense probably null
IGL01665:Adgra3 APN 5 50006930 missense possibly damaging 0.64
IGL02151:Adgra3 APN 5 49979142 missense probably benign
IGL02239:Adgra3 APN 5 49960712 missense probably damaging 1.00
IGL02351:Adgra3 APN 5 50058558 missense probably benign 0.19
IGL02358:Adgra3 APN 5 50058558 missense probably benign 0.19
IGL02938:Adgra3 APN 5 49961317 missense probably benign 0.01
IGL03028:Adgra3 APN 5 50016852 missense probably benign 0.30
aperture UTSW 5 49999145 nonsense probably null
saltatory UTSW 5 49960559 missense probably benign 0.09
ANU74:Adgra3 UTSW 5 49961038 missense probably benign 0.16
R0041:Adgra3 UTSW 5 49960559 missense probably benign 0.09
R0121:Adgra3 UTSW 5 50025786 splice site probably benign
R0125:Adgra3 UTSW 5 50001852 splice site probably benign
R0137:Adgra3 UTSW 5 49963840 splice site probably benign
R0415:Adgra3 UTSW 5 49961757 splice site probably benign
R0479:Adgra3 UTSW 5 49990265 missense probably benign 0.00
R0505:Adgra3 UTSW 5 50009334 critical splice donor site probably null
R0831:Adgra3 UTSW 5 49970802 missense probably damaging 1.00
R0883:Adgra3 UTSW 5 49960723 missense probably damaging 1.00
R0920:Adgra3 UTSW 5 49961161 missense probably benign 0.19
R1139:Adgra3 UTSW 5 49961755 splice site probably null
R1211:Adgra3 UTSW 5 50006876 missense possibly damaging 0.88
R1370:Adgra3 UTSW 5 49960787 missense possibly damaging 0.56
R1530:Adgra3 UTSW 5 49961137 missense probably benign 0.00
R1703:Adgra3 UTSW 5 50006775 missense probably benign 0.00
R1782:Adgra3 UTSW 5 49972062 missense probably benign 0.02
R1843:Adgra3 UTSW 5 49961492 missense probably damaging 1.00
R2157:Adgra3 UTSW 5 50001941 missense possibly damaging 0.87
R2281:Adgra3 UTSW 5 50001880 missense probably benign 0.04
R2385:Adgra3 UTSW 5 49979566 missense possibly damaging 0.95
R2426:Adgra3 UTSW 5 50009449 missense possibly damaging 0.61
R3084:Adgra3 UTSW 5 50013391 critical splice donor site probably null
R3086:Adgra3 UTSW 5 50013391 critical splice donor site probably null
R3409:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R3410:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R3411:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R4301:Adgra3 UTSW 5 49961078 missense possibly damaging 0.94
R4360:Adgra3 UTSW 5 49990210 missense possibly damaging 0.92
R4475:Adgra3 UTSW 5 50001898 missense probably damaging 1.00
R4569:Adgra3 UTSW 5 49960563 missense probably damaging 1.00
R4607:Adgra3 UTSW 5 49970739 missense probably damaging 0.98
R4667:Adgra3 UTSW 5 49978956 missense possibly damaging 0.94
R4671:Adgra3 UTSW 5 49979368 missense probably damaging 1.00
R4886:Adgra3 UTSW 5 49999195 missense probably benign 0.07
R5197:Adgra3 UTSW 5 49960754 missense probably benign 0.01
R5208:Adgra3 UTSW 5 50011515 missense probably damaging 0.99
R5313:Adgra3 UTSW 5 49961309 missense probably benign 0.24
R5435:Adgra3 UTSW 5 49990126 missense probably damaging 0.99
R5663:Adgra3 UTSW 5 49999285 missense probably benign 0.14
R6038:Adgra3 UTSW 5 49999145 nonsense probably null
R6038:Adgra3 UTSW 5 49999145 nonsense probably null
R6064:Adgra3 UTSW 5 49960325 missense probably damaging 0.97
R6259:Adgra3 UTSW 5 49999141 missense possibly damaging 0.63
R6272:Adgra3 UTSW 5 50009449 missense possibly damaging 0.61
R6293:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6296:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6297:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6352:Adgra3 UTSW 5 49979136 missense probably benign
R6352:Adgra3 UTSW 5 49990250 missense probably benign 0.01
R6989:Adgra3 UTSW 5 50006884 missense probably damaging 1.00
R7026:Adgra3 UTSW 5 49960741 missense probably benign
R7147:Adgra3 UTSW 5 49961245 missense probably damaging 1.00
R7206:Adgra3 UTSW 5 50006896 missense probably damaging 1.00
R7381:Adgra3 UTSW 5 50058774 start codon destroyed probably null
R7508:Adgra3 UTSW 5 50016867 missense probably benign 0.10
R7538:Adgra3 UTSW 5 49961450 missense probably benign 0.01
R7579:Adgra3 UTSW 5 49987635 missense probably benign
R7951:Adgra3 UTSW 5 49963784 missense probably damaging 1.00
R8269:Adgra3 UTSW 5 49963737 missense probably damaging 0.98
R8458:Adgra3 UTSW 5 49987671 missense probably damaging 0.99
R8486:Adgra3 UTSW 5 49990279 missense probably damaging 0.98
R8912:Adgra3 UTSW 5 49960931 missense possibly damaging 0.61
R8955:Adgra3 UTSW 5 49961389 missense probably benign 0.05
R9108:Adgra3 UTSW 5 49978953 missense probably damaging 1.00
R9112:Adgra3 UTSW 5 49961053 missense probably damaging 1.00
R9191:Adgra3 UTSW 5 49987664 missense possibly damaging 0.88
R9267:Adgra3 UTSW 5 49998276 missense possibly damaging 0.87
R9312:Adgra3 UTSW 5 49960558 missense probably damaging 1.00
R9614:Adgra3 UTSW 5 50006908 missense probably damaging 1.00
RF005:Adgra3 UTSW 5 50013387 splice site probably null
RF024:Adgra3 UTSW 5 50013387 splice site probably null
RF036:Adgra3 UTSW 5 50058641 small deletion probably benign
X0065:Adgra3 UTSW 5 49971962 missense probably benign
Z1187:Adgra3 UTSW 5 49979079 missense probably damaging 1.00
Z1192:Adgra3 UTSW 5 49999281 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGGCATACTCTCGCAGGACTG -3'
(R):5'- TGGATCATGATGTGCTGCCC -3'

Sequencing Primer
(F):5'- AGGACTGTGAGCCTGCTG -3'
(R):5'- ACTAATGGAGAGGCTCCA -3'
Posted On 2022-07-18