Mutagenetix > Incidental Mutation

Incidental Mutation 'R9537:Adgra3'

719737

Institutional Source

Beutler Lab

Gene Symbol

Adgra3

Ensembl Gene

ENSMUSG00000029090

Gene Name

adhesion G protein-coupled receptor A3

Synonyms

Gpr125, Tem5-like, 3830613O22Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9537 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

49959956-50059006 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 49960865 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1114 (Y1114H)

Ref Sequence

ENSEMBL: ENSMUSP00000030971 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030971]

AlphaFold

Q7TT36

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030971
AA Change: Y1114H

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000030971
Gene: ENSMUSG00000029090
AA Change: Y1114H

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	36	48	N/A	INTRINSIC
LRR	68	92	1.71e1	SMART
LRR_TYP	93	116	2.27e-4	SMART
LRR_TYP	117	140	4.11e-2	SMART
LRR_TYP	141	164	3.89e-3	SMART
LRRCT	176	225	5.24e-5	SMART
IG	238	331	8.26e-5	SMART
GPS	686	738	4.81e-3	SMART
Pfam:7tm_2	746	1031	1.6e-16	PFAM
low complexity region	1251	1262	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor superfamily. This membrane protein may play a role in tumor angiogenesis through its interaction with the human homolog of the Drosophila disc large tumor suppressor gene. This gene is mapped to a candidate region of chromosome 4 which may be associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous mutant mice are fertile and grossly normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	T	C	1: 93,153,162	K341E	possibly damaging	Het
Atp5j	A	G	16: 84,828,470	Y82H	probably damaging	Het
Bcl2a1d	T	G	9: 88,731,473	I83L	probably benign	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Bglap3	T	C	3: 88,368,832	D71G	probably benign	Het
Bnip3l	G	A	14: 67,008,765	P7L	possibly damaging	Het
Chmp2b	T	C	16: 65,551,046	K15E	probably benign	Het
Chrm3	A	T	13: 9,877,426	W525R	probably damaging	Het
Col7a1	A	T	9: 108,955,352	K143*	probably null	Het
D6Ertd527e	G	C	6: 87,111,857	S334T	unknown	Het
Dnaic1	A	G	4: 41,629,790		probably null	Het
Dnhd1	G	A	7: 105,695,533	G2028D	probably damaging	Het
Esyt3	C	T	9: 99,317,239	R773Q	probably damaging	Het
Ffar1	T	C	7: 30,860,600	T291A	probably benign	Het
Gm5767	G	T	16: 8,683,313	C11F		Het
Golga2	G	T	2: 32,288,301		probably benign	Het
Hapln2	T	A	3: 88,024,473		probably null	Het
Ing1	T	C	8: 11,561,889	L203P	probably benign	Het
Med1	T	C	11: 98,171,760	T171A	possibly damaging	Het
Mib2	A	T	4: 155,657,495	L387H	probably damaging	Het
Mier1	A	G	4: 103,162,561	N494S	probably benign	Het
Myof	A	G	19: 37,907,606	L1847P	probably damaging	Het
Ndst3	A	T	3: 123,671,513	V270D		Het
Nup160	T	C	2: 90,729,744	L1271S	possibly damaging	Het
Osgep	A	T	14: 50,924,662		probably null	Het
Ptgfr	G	T	3: 151,835,808	T21N	possibly damaging	Het
Ptgs1	T	C	2: 36,230,727	S23P	unknown	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,914		probably benign	Het
Smu1	A	G	4: 40,755,671	S65P	probably benign	Het
Spef2	T	C	15: 9,601,799	Y1459C	unknown	Het
Spen	A	G	4: 141,471,704	V3204A	probably benign	Het
Spen	TTGCTGCTGCTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTGCTG	4: 141,516,845		probably benign	Het
Timm44	G	A	8: 4,260,576	T392I	possibly damaging	Het
Tnc	A	T	4: 63,966,584	I1818N	probably damaging	Het
Trpm1	G	T	7: 64,153,868		probably benign	Het
Ttc14	A	G	3: 33,803,198	Y231C	probably damaging	Het
Ube3b	A	G	5: 114,387,184	R23G	probably damaging	Het
Usp40	T	C	1: 88,007,395	Y10C	probably benign	Het
Vmn2r107	C	A	17: 20,374,887	S567R	probably benign	Het
Zfp112	T	C	7: 24,127,087	Y831H	probably damaging	Het
Zfy2	T	A	Y: 2,108,596	T355S		Het

Other mutations in Adgra3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Adgra3	APN	5	50025758	missense	probably damaging	1.00
IGL00848:Adgra3	APN	5	50001949	missense	probably damaging	1.00
IGL01455:Adgra3	APN	5	49987557	nonsense	probably null
IGL01665:Adgra3	APN	5	50006930	missense	possibly damaging	0.64
IGL02151:Adgra3	APN	5	49979142	missense	probably benign
IGL02239:Adgra3	APN	5	49960712	missense	probably damaging	1.00
IGL02351:Adgra3	APN	5	50058558	missense	probably benign	0.19
IGL02358:Adgra3	APN	5	50058558	missense	probably benign	0.19
IGL02938:Adgra3	APN	5	49961317	missense	probably benign	0.01
IGL03028:Adgra3	APN	5	50016852	missense	probably benign	0.30
aperture	UTSW	5	49999145	nonsense	probably null
saltatory	UTSW	5	49960559	missense	probably benign	0.09
ANU74:Adgra3	UTSW	5	49961038	missense	probably benign	0.16
R0041:Adgra3	UTSW	5	49960559	missense	probably benign	0.09
R0121:Adgra3	UTSW	5	50025786	splice site	probably benign
R0125:Adgra3	UTSW	5	50001852	splice site	probably benign
R0137:Adgra3	UTSW	5	49963840	splice site	probably benign
R0415:Adgra3	UTSW	5	49961757	splice site	probably benign
R0479:Adgra3	UTSW	5	49990265	missense	probably benign	0.00
R0505:Adgra3	UTSW	5	50009334	critical splice donor site	probably null
R0831:Adgra3	UTSW	5	49970802	missense	probably damaging	1.00
R0883:Adgra3	UTSW	5	49960723	missense	probably damaging	1.00
R0920:Adgra3	UTSW	5	49961161	missense	probably benign	0.19
R1139:Adgra3	UTSW	5	49961755	splice site	probably null
R1211:Adgra3	UTSW	5	50006876	missense	possibly damaging	0.88
R1370:Adgra3	UTSW	5	49960787	missense	possibly damaging	0.56
R1530:Adgra3	UTSW	5	49961137	missense	probably benign	0.00
R1703:Adgra3	UTSW	5	50006775	missense	probably benign	0.00
R1782:Adgra3	UTSW	5	49972062	missense	probably benign	0.02
R1843:Adgra3	UTSW	5	49961492	missense	probably damaging	1.00
R2157:Adgra3	UTSW	5	50001941	missense	possibly damaging	0.87
R2281:Adgra3	UTSW	5	50001880	missense	probably benign	0.04
R2385:Adgra3	UTSW	5	49979566	missense	possibly damaging	0.95
R2426:Adgra3	UTSW	5	50009449	missense	possibly damaging	0.61
R3084:Adgra3	UTSW	5	50013391	critical splice donor site	probably null
R3086:Adgra3	UTSW	5	50013391	critical splice donor site	probably null
R3409:Adgra3	UTSW	5	50001930	missense	probably damaging	1.00
R3410:Adgra3	UTSW	5	50001930	missense	probably damaging	1.00
R3411:Adgra3	UTSW	5	50001930	missense	probably damaging	1.00
R4301:Adgra3	UTSW	5	49961078	missense	possibly damaging	0.94
R4360:Adgra3	UTSW	5	49990210	missense	possibly damaging	0.92
R4475:Adgra3	UTSW	5	50001898	missense	probably damaging	1.00
R4569:Adgra3	UTSW	5	49960563	missense	probably damaging	1.00
R4607:Adgra3	UTSW	5	49970739	missense	probably damaging	0.98
R4667:Adgra3	UTSW	5	49978956	missense	possibly damaging	0.94
R4671:Adgra3	UTSW	5	49979368	missense	probably damaging	1.00
R4886:Adgra3	UTSW	5	49999195	missense	probably benign	0.07
R5197:Adgra3	UTSW	5	49960754	missense	probably benign	0.01
R5208:Adgra3	UTSW	5	50011515	missense	probably damaging	0.99
R5313:Adgra3	UTSW	5	49961309	missense	probably benign	0.24
R5435:Adgra3	UTSW	5	49990126	missense	probably damaging	0.99
R5663:Adgra3	UTSW	5	49999285	missense	probably benign	0.14
R6038:Adgra3	UTSW	5	49999145	nonsense	probably null
R6038:Adgra3	UTSW	5	49999145	nonsense	probably null
R6064:Adgra3	UTSW	5	49960325	missense	probably damaging	0.97
R6259:Adgra3	UTSW	5	49999141	missense	possibly damaging	0.63
R6272:Adgra3	UTSW	5	50009449	missense	possibly damaging	0.61
R6293:Adgra3	UTSW	5	49960847	missense	probably benign	0.21
R6296:Adgra3	UTSW	5	49960847	missense	probably benign	0.21
R6297:Adgra3	UTSW	5	49960847	missense	probably benign	0.21
R6352:Adgra3	UTSW	5	49979136	missense	probably benign
R6352:Adgra3	UTSW	5	49990250	missense	probably benign	0.01
R6989:Adgra3	UTSW	5	50006884	missense	probably damaging	1.00
R7026:Adgra3	UTSW	5	49960741	missense	probably benign
R7147:Adgra3	UTSW	5	49961245	missense	probably damaging	1.00
R7206:Adgra3	UTSW	5	50006896	missense	probably damaging	1.00
R7381:Adgra3	UTSW	5	50058774	start codon destroyed	probably null
R7508:Adgra3	UTSW	5	50016867	missense	probably benign	0.10
R7538:Adgra3	UTSW	5	49961450	missense	probably benign	0.01
R7579:Adgra3	UTSW	5	49987635	missense	probably benign
R7951:Adgra3	UTSW	5	49963784	missense	probably damaging	1.00
R8269:Adgra3	UTSW	5	49963737	missense	probably damaging	0.98
R8458:Adgra3	UTSW	5	49987671	missense	probably damaging	0.99
R8486:Adgra3	UTSW	5	49990279	missense	probably damaging	0.98
R8912:Adgra3	UTSW	5	49960931	missense	possibly damaging	0.61
R8955:Adgra3	UTSW	5	49961389	missense	probably benign	0.05
R9108:Adgra3	UTSW	5	49978953	missense	probably damaging	1.00
R9112:Adgra3	UTSW	5	49961053	missense	probably damaging	1.00
R9191:Adgra3	UTSW	5	49987664	missense	possibly damaging	0.88
R9267:Adgra3	UTSW	5	49998276	missense	possibly damaging	0.87
R9312:Adgra3	UTSW	5	49960558	missense	probably damaging	1.00
R9614:Adgra3	UTSW	5	50006908	missense	probably damaging	1.00
RF005:Adgra3	UTSW	5	50013387	splice site	probably null
RF024:Adgra3	UTSW	5	50013387	splice site	probably null
RF036:Adgra3	UTSW	5	50058641	small deletion	probably benign
X0065:Adgra3	UTSW	5	49971962	missense	probably benign
Z1187:Adgra3	UTSW	5	49979079	missense	probably damaging	1.00
Z1192:Adgra3	UTSW	5	49999281	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TAGGCATACTCTCGCAGGACTG -3'
(R):5'- TGGATCATGATGTGCTGCCC -3'

Sequencing Primer
(F):5'- AGGACTGTGAGCCTGCTG -3'
(R):5'- ACTAATGGAGAGGCTCCA -3'

Posted On

2022-07-18