Incidental Mutation 'R1065:Slit3'
List |< first << previous [record 23 of 36] next >> last >|
ID85971
Institutional Source Beutler Lab
Gene Symbol Slit3
Ensembl Gene ENSMUSG00000056427
Gene Nameslit guidance ligand 3
SynonymsSlit1
MMRRC Submission 039151-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock #R1065 (G1)
Quality Score155
Status Validated
Chromosome11
Chromosomal Location35121224-35708507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35121635 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 41 (S41P)
Ref Sequence ENSEMBL: ENSMUSP00000066857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069837]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069837
AA Change: S41P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066857
Gene: ENSMUSG00000056427
AA Change: S41P

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
LRRNT 33 65 2.12e-8 SMART
LRR 59 83 1.37e2 SMART
LRR_TYP 84 107 1.12e-3 SMART
LRR_TYP 108 131 7.78e-3 SMART
LRR_TYP 132 155 5.42e-2 SMART
LRR 156 179 5.88e0 SMART
LRR 180 203 7.55e-1 SMART
LRRCT 215 264 1.33e-6 SMART
LRRNT 279 311 6.79e-7 SMART
LRR 305 329 1.16e2 SMART
LRR 330 353 1.26e1 SMART
LRR_TYP 354 377 2.79e-4 SMART
LRR 378 401 4.05e-1 SMART
LRR 402 425 4.05e-1 SMART
LRRCT 437 486 7.75e-8 SMART
LRRNT 504 536 1.95e-7 SMART
LRR_TYP 556 579 7.49e-5 SMART
LRR 581 603 6.41e1 SMART
LRR_TYP 604 627 2.53e-2 SMART
LRR 628 651 1.76e-1 SMART
LRRCT 663 712 2.52e-7 SMART
LRRNT 724 756 3e-8 SMART
LRR 774 797 2.14e0 SMART
LRR_TYP 798 821 2.95e-3 SMART
LRR_TYP 822 845 2.43e-4 SMART
LRRCT 857 906 1.12e-13 SMART
EGF 919 953 6.86e-4 SMART
EGF 958 994 8.84e-7 SMART
EGF 999 1032 1.13e-4 SMART
EGF 1037 1072 2.3e-5 SMART
EGF_CA 1074 1110 5.92e-8 SMART
EGF 1122 1155 3.79e-6 SMART
LamG 1178 1314 3.16e-34 SMART
EGF 1331 1365 2.19e-2 SMART
EGF 1371 1403 1.13e-4 SMART
EGF 1411 1444 5.57e-4 SMART
CT 1455 1523 4.56e-5 SMART
Meta Mutation Damage Score 0.1884 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is secreted, likely interacting with roundabout homolog receptors to effect cell migration. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a gene trap allele show congenital diaphragmatic hernia (CDH), variable renal defects and enlarged heart right ventricles. Mice homozygous for either of two reporter alleles show diaphragm dysgenesis and die prematurely; those with end-stage CDH show dyspnea and lung congestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,323,050 I155T possibly damaging Het
Cd300ld2 T C 11: 115,013,760 T94A probably damaging Het
Cdc42bpg G A 19: 6,322,826 S1515N probably damaging Het
Ckb T C 12: 111,671,247 E150G probably benign Het
Cobl T A 11: 12,254,327 M785L possibly damaging Het
Col6a5 T C 9: 105,881,783 N2075D probably damaging Het
Commd7 G C 2: 153,619,527 probably benign Het
Corin G A 5: 72,301,650 R927* probably null Het
Ift122 A T 6: 115,875,325 probably null Het
Il1b G A 2: 129,368,007 T83I probably benign Het
Ints4 T C 7: 97,507,892 probably null Het
Msh6 T G 17: 87,988,463 probably benign Het
Mtmr3 T C 11: 4,492,859 K392E probably damaging Het
Olfr1094 A G 2: 86,829,544 H264R probably damaging Het
Pde3a T C 6: 141,476,732 probably benign Het
Pde6h A C 6: 136,959,370 K37T probably damaging Het
Plat C A 8: 22,776,863 D290E probably damaging Het
Polk A C 13: 96,508,252 L122R probably damaging Het
Ppp1r3g T A 13: 35,969,435 D279E probably benign Het
Ptpru T C 4: 131,808,340 E370G possibly damaging Het
Ralgapa2 T C 2: 146,450,558 Y187C probably benign Het
Rps6ka2 C T 17: 7,281,758 probably benign Het
Smarca5 A T 8: 80,704,714 L958Q probably damaging Het
Snx9 T C 17: 5,902,361 probably benign Het
Stkld1 A T 2: 26,940,038 N72I probably damaging Het
Strc C A 2: 121,366,651 D1532Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Svil T G 18: 5,063,777 probably benign Het
Traf3ip1 T A 1: 91,500,784 D122E unknown Het
Vmn2r7 A T 3: 64,707,138 D509E possibly damaging Het
Vps52 C A 17: 33,961,239 Q306K probably benign Het
Wdr60 C T 12: 116,256,076 R82H probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp418 C A 7: 7,181,562 Q175K probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Slit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Slit3 APN 11 35622154 missense probably damaging 1.00
IGL01324:Slit3 APN 11 35610702 missense probably damaging 1.00
IGL01612:Slit3 APN 11 35700384 missense possibly damaging 0.95
IGL02145:Slit3 APN 11 35629742 missense probably damaging 0.99
IGL02146:Slit3 APN 11 35234848 missense possibly damaging 0.71
IGL02430:Slit3 APN 11 35177774 splice site probably null
IGL02528:Slit3 APN 11 35578974 missense probably benign
IGL02530:Slit3 APN 11 35708142 makesense probably null
IGL02640:Slit3 APN 11 35700345 missense probably benign 0.10
IGL02819:Slit3 APN 11 35171590 missense possibly damaging 0.71
IGL02839:Slit3 APN 11 35649047 missense possibly damaging 0.46
IGL03150:Slit3 APN 11 35508257 missense possibly damaging 0.88
IGL03161:Slit3 APN 11 35700414 missense probably benign 0.10
IGL03336:Slit3 APN 11 35670101 missense probably damaging 0.97
Bloated UTSW 11 35633952 missense possibly damaging 0.55
Quellung UTSW 11 35651820 critical splice donor site probably null
IGL02988:Slit3 UTSW 11 35708063 missense probably damaging 0.99
PIT4791001:Slit3 UTSW 11 35661245 missense possibly damaging 0.85
R0013:Slit3 UTSW 11 35707918 missense probably benign
R0013:Slit3 UTSW 11 35707918 missense probably benign
R0334:Slit3 UTSW 11 35579101 missense probably damaging 0.97
R0385:Slit3 UTSW 11 35700282 missense probably damaging 0.98
R0840:Slit3 UTSW 11 35623436 splice site probably benign
R1364:Slit3 UTSW 11 35670107 missense probably benign
R1476:Slit3 UTSW 11 35686299 missense probably damaging 0.97
R1508:Slit3 UTSW 11 35570621 missense probably damaging 1.00
R1665:Slit3 UTSW 11 35234906 missense possibly damaging 0.71
R1692:Slit3 UTSW 11 35659344 missense probably damaging 1.00
R1696:Slit3 UTSW 11 35675923 missense probably damaging 0.99
R1727:Slit3 UTSW 11 35629832 missense probably damaging 1.00
R1752:Slit3 UTSW 11 35564653 missense probably damaging 0.98
R1970:Slit3 UTSW 11 35630841 critical splice acceptor site probably null
R2077:Slit3 UTSW 11 35544748 missense possibly damaging 0.88
R2126:Slit3 UTSW 11 35688679 missense probably damaging 1.00
R2143:Slit3 UTSW 11 35612261 splice site probably null
R2162:Slit3 UTSW 11 35688682 missense probably null 1.00
R2873:Slit3 UTSW 11 35544793 nonsense probably null
R3813:Slit3 UTSW 11 35675979 missense probably damaging 1.00
R3831:Slit3 UTSW 11 35688682 missense probably null 1.00
R3832:Slit3 UTSW 11 35688682 missense probably null 1.00
R3833:Slit3 UTSW 11 35688682 missense probably null 1.00
R3839:Slit3 UTSW 11 35508237 missense probably benign 0.10
R4152:Slit3 UTSW 11 35698320 missense probably damaging 0.98
R4387:Slit3 UTSW 11 35684048 missense probably benign 0.12
R4795:Slit3 UTSW 11 35651820 critical splice donor site probably null
R4910:Slit3 UTSW 11 35632722 missense probably damaging 0.99
R4933:Slit3 UTSW 11 35688593 missense probably damaging 1.00
R5048:Slit3 UTSW 11 35588985 missense probably damaging 1.00
R5106:Slit3 UTSW 11 35612367 missense probably damaging 1.00
R5138:Slit3 UTSW 11 35588985 missense probably damaging 1.00
R5218:Slit3 UTSW 11 35684175 critical splice donor site probably null
R5338:Slit3 UTSW 11 35622148 missense probably benign
R5354:Slit3 UTSW 11 35675913 missense probably damaging 1.00
R5436:Slit3 UTSW 11 35707911 missense probably benign 0.05
R5896:Slit3 UTSW 11 35708105 missense probably damaging 0.99
R5933:Slit3 UTSW 11 35629751 missense probably benign 0.04
R5963:Slit3 UTSW 11 35700236 missense probably damaging 1.00
R5964:Slit3 UTSW 11 35700236 missense probably damaging 1.00
R6125:Slit3 UTSW 11 35570733 critical splice donor site probably null
R6153:Slit3 UTSW 11 35700483 missense possibly damaging 0.69
R6484:Slit3 UTSW 11 35661298 missense probably benign
R6526:Slit3 UTSW 11 35661292 missense probably benign 0.33
R6797:Slit3 UTSW 11 35633952 missense possibly damaging 0.55
R6887:Slit3 UTSW 11 35544806 splice site probably null
R7067:Slit3 UTSW 11 35508230 missense probably benign 0.04
R7150:Slit3 UTSW 11 35570719 missense probably damaging 1.00
R7228:Slit3 UTSW 11 35599418 missense probably damaging 1.00
R7232:Slit3 UTSW 11 35610689 missense possibly damaging 0.87
R7418:Slit3 UTSW 11 35686428 missense possibly damaging 0.64
R7545:Slit3 UTSW 11 35700312 missense possibly damaging 0.52
R7727:Slit3 UTSW 11 35684044 missense probably damaging 1.00
R7820:Slit3 UTSW 11 35700408 missense probably benign 0.23
R8177:Slit3 UTSW 11 35579092 missense probably damaging 0.99
R8179:Slit3 UTSW 11 35664076 missense probably benign 0.31
R8416:Slit3 UTSW 11 35508235 missense probably benign 0.08
R8417:Slit3 UTSW 11 35610611 missense probably damaging 0.99
X0028:Slit3 UTSW 11 35564637 missense probably damaging 0.99
Z1176:Slit3 UTSW 11 35707924 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACCTGGGCACCGTGAGTGATG -3'
(R):5'- AAAGAAGGACCTGCGCCCTGAG -3'

Sequencing Primer
(F):5'- ccctcctccgcgctaac -3'
(R):5'- AGGGCGACTCTGTAGGAGC -3'
Posted On2013-11-18