Incidental Mutation 'R1126:Nipsnap1'
ID96181
Institutional Source Beutler Lab
Gene Symbol Nipsnap1
Ensembl Gene ENSMUSG00000034285
Gene Namenipsnap homolog 1
Synonyms
MMRRC Submission 039199-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R1126 (G1)
Quality Score196
Status Not validated
Chromosome11
Chromosomal Location4873951-4894200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4884081 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 90 (N90S)
Ref Sequence ENSEMBL: ENSMUSP00000122885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038570] [ENSMUST00000136552] [ENSMUST00000139737]
Predicted Effect probably benign
Transcript: ENSMUST00000038570
AA Change: N111S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000049338
Gene: ENSMUSG00000034285
AA Change: N111S

DomainStartEndE-ValueType
Pfam:NIPSNAP 185 282 2.7e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135405
Predicted Effect probably benign
Transcript: ENSMUST00000136552
Predicted Effect probably benign
Transcript: ENSMUST00000139737
AA Change: N90S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149603
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NipSnap family of proteins that may be involved in vesicular transport. A similar protein in mice inhibits the calcium channel TRPV6, and is also localized to the inner mitochondrial membrane where it may play a role in mitochondrial DNA maintenance. A pseudogene of this gene is located on the short arm of chromosome 17. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele treated with nocistatin fail to exhibit suppression of neuropeptide nociceptin/orphanin FQ-induced tactile allodynia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,109,638 E1226G probably damaging Het
Arhgef40 G T 14: 51,997,126 S962I probably damaging Het
Atp9b A T 18: 80,778,954 M477K probably damaging Het
Enpp2 C T 15: 54,906,826 probably null Het
Ephb3 T A 16: 21,222,476 M727K possibly damaging Het
Exo5 A T 4: 120,922,125 I181N probably damaging Het
Fbn1 T C 2: 125,321,192 probably null Het
Gas6 T C 8: 13,483,700 N103S probably benign Het
Gm11596 A T 11: 99,792,873 C140* probably null Het
Il6st T C 13: 112,503,732 Y681H probably damaging Het
Itih4 T C 14: 30,889,961 probably null Het
Kdm5b C T 1: 134,613,991 A768V possibly damaging Het
Krt83 A T 15: 101,487,482 N336K probably damaging Het
Mfsd6 A G 1: 52,709,511 V65A probably benign Het
Nlrp9a C A 7: 26,560,741 D640E probably benign Het
Olfr137 A G 17: 38,304,688 C258R probably damaging Het
Olfr365 A T 2: 37,202,101 M287L probably benign Het
Olfr473 A C 7: 107,934,371 M284L possibly damaging Het
Olfr747 C T 14: 50,681,263 A124T possibly damaging Het
Parp9 G A 16: 35,947,740 V97I possibly damaging Het
Pdzd2 T C 15: 12,458,220 T12A possibly damaging Het
Penk T C 4: 4,138,119 T9A probably benign Het
Pilrb2 T C 5: 137,870,960 D126G probably damaging Het
Pkdrej A T 15: 85,816,314 V1807E probably damaging Het
Ppp1r9a A G 6: 4,906,795 E450G possibly damaging Het
Rag1 T C 2: 101,642,689 R703G probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rmdn3 T C 2: 119,153,995 D92G probably benign Het
Rp1l1 G A 14: 64,030,469 G1168D probably damaging Het
Saxo1 T A 4: 86,478,987 T105S probably benign Het
Slc39a2 G A 14: 51,894,145 G58R probably damaging Het
Tbx6 C T 7: 126,784,719 T315I probably damaging Het
Tcf12 A G 9: 72,000,433 M99T probably benign Het
Tdrd3 A G 14: 87,480,774 D197G probably damaging Het
Tnc T C 4: 64,018,120 N193S probably damaging Het
Ttn A G 2: 76,850,003 probably benign Het
Vmn1r225 A G 17: 20,502,326 I10V probably benign Het
Zp3r A G 1: 130,618,342 L77P probably damaging Het
Other mutations in Nipsnap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Nipsnap1 APN 11 4889098 missense possibly damaging 0.77
IGL01552:Nipsnap1 APN 11 4889124 missense probably damaging 1.00
IGL01744:Nipsnap1 APN 11 4889912 missense probably damaging 1.00
IGL01938:Nipsnap1 APN 11 4893134 missense probably benign 0.00
IGL03328:Nipsnap1 APN 11 4884096 missense possibly damaging 0.89
R0355:Nipsnap1 UTSW 11 4889957 missense probably damaging 1.00
R1815:Nipsnap1 UTSW 11 4889101 missense probably damaging 1.00
R2129:Nipsnap1 UTSW 11 4888932 missense probably benign 0.04
R2205:Nipsnap1 UTSW 11 4889974 missense possibly damaging 0.95
R4852:Nipsnap1 UTSW 11 4891468 nonsense probably null
R5776:Nipsnap1 UTSW 11 4888919 missense probably benign 0.00
R6073:Nipsnap1 UTSW 11 4888895 missense possibly damaging 0.86
R7122:Nipsnap1 UTSW 11 4883366 critical splice acceptor site probably null
R7263:Nipsnap1 UTSW 11 4882960 unclassified probably benign
R7538:Nipsnap1 UTSW 11 4884089 missense probably damaging 1.00
R7947:Nipsnap1 UTSW 11 4889145 missense possibly damaging 0.64
R8166:Nipsnap1 UTSW 11 4884057 missense probably benign 0.00
X0011:Nipsnap1 UTSW 11 4874069 missense probably benign
Z1177:Nipsnap1 UTSW 11 4889956 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATGCCTACAACAGTCTGACGTGAG -3'
(R):5'- GCCTGAGAACACTGAGTAGCCAAC -3'

Sequencing Primer
(F):5'- TGTTCTCCAGACACAGTCAAGG -3'
(R):5'- AGGTGTTTGAGTAGGGCAATG -3'
Posted On2014-01-05