Incidental Mutation 'R1126:Krt83'
ID96219
Institutional Source Beutler Lab
Gene Symbol Krt83
Ensembl Gene ENSMUSG00000047641
Gene Namekeratin 83
SynonymsKrt2-25
MMRRC Submission 039199-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1126 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101431490-101438804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101487482 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 336 (N336K)
Ref Sequence ENSEMBL: ENSMUSP00000023718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023718]
Predicted Effect probably damaging
Transcript: ENSMUST00000023718
AA Change: N336K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023718
Gene: ENSMUSG00000067613
AA Change: N336K

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 100 5.9e-16 PFAM
Filament 103 414 7.02e-149 SMART
low complexity region 422 436 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230173
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,109,638 E1226G probably damaging Het
Arhgef40 G T 14: 51,997,126 S962I probably damaging Het
Atp9b A T 18: 80,778,954 M477K probably damaging Het
Enpp2 C T 15: 54,906,826 probably null Het
Ephb3 T A 16: 21,222,476 M727K possibly damaging Het
Exo5 A T 4: 120,922,125 I181N probably damaging Het
Fbn1 T C 2: 125,321,192 probably null Het
Gas6 T C 8: 13,483,700 N103S probably benign Het
Gm11596 A T 11: 99,792,873 C140* probably null Het
Il6st T C 13: 112,503,732 Y681H probably damaging Het
Itih4 T C 14: 30,889,961 probably null Het
Kdm5b C T 1: 134,613,991 A768V possibly damaging Het
Mfsd6 A G 1: 52,709,511 V65A probably benign Het
Nipsnap1 A G 11: 4,884,081 N90S probably benign Het
Nlrp9a C A 7: 26,560,741 D640E probably benign Het
Olfr137 A G 17: 38,304,688 C258R probably damaging Het
Olfr365 A T 2: 37,202,101 M287L probably benign Het
Olfr473 A C 7: 107,934,371 M284L possibly damaging Het
Olfr747 C T 14: 50,681,263 A124T possibly damaging Het
Parp9 G A 16: 35,947,740 V97I possibly damaging Het
Pdzd2 T C 15: 12,458,220 T12A possibly damaging Het
Penk T C 4: 4,138,119 T9A probably benign Het
Pilrb2 T C 5: 137,870,960 D126G probably damaging Het
Pkdrej A T 15: 85,816,314 V1807E probably damaging Het
Ppp1r9a A G 6: 4,906,795 E450G possibly damaging Het
Rag1 T C 2: 101,642,689 R703G probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rmdn3 T C 2: 119,153,995 D92G probably benign Het
Rp1l1 G A 14: 64,030,469 G1168D probably damaging Het
Saxo1 T A 4: 86,478,987 T105S probably benign Het
Slc39a2 G A 14: 51,894,145 G58R probably damaging Het
Tbx6 C T 7: 126,784,719 T315I probably damaging Het
Tcf12 A G 9: 72,000,433 M99T probably benign Het
Tdrd3 A G 14: 87,480,774 D197G probably damaging Het
Tnc T C 4: 64,018,120 N193S probably damaging Het
Ttn A G 2: 76,850,003 probably benign Het
Vmn1r225 A G 17: 20,502,326 I10V probably benign Het
Zp3r A G 1: 130,618,342 L77P probably damaging Het
Other mutations in Krt83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Krt83 APN 15 101488211 missense probably benign 0.17
IGL01315:Krt83 APN 15 101486967 splice site probably benign
IGL01702:Krt83 APN 15 101491218 missense probably benign 0.18
IGL02123:Krt83 APN 15 101487585 missense possibly damaging 0.49
IGL02353:Krt83 APN 15 101485458 missense probably benign
IGL02360:Krt83 APN 15 101485458 missense probably benign
IGL02395:Krt83 APN 15 101487952 missense probably benign 0.18
IGL02633:Krt83 APN 15 101491214 missense probably damaging 1.00
R0357:Krt83 UTSW 15 101487019 missense probably benign 0.17
R0650:Krt83 UTSW 15 101487040 missense probably damaging 0.99
R0928:Krt83 UTSW 15 101491280 missense probably benign 0.00
R1196:Krt83 UTSW 15 101491433 missense probably benign 0.03
R1252:Krt83 UTSW 15 101487830 missense probably damaging 1.00
R1513:Krt83 UTSW 15 101489657 missense probably benign 0.30
R1612:Krt83 UTSW 15 101488211 missense probably benign 0.17
R1870:Krt83 UTSW 15 101487190 missense probably benign
R2173:Krt83 UTSW 15 101487937 missense probably damaging 0.98
R2432:Krt83 UTSW 15 101488156 nonsense probably null
R2568:Krt83 UTSW 15 101487827 missense possibly damaging 0.67
R2696:Krt83 UTSW 15 101487009 missense probably benign 0.01
R3508:Krt83 UTSW 15 101488158 missense probably benign 0.04
R4364:Krt83 UTSW 15 101487514 missense probably benign
R4366:Krt83 UTSW 15 101487514 missense probably benign
R4606:Krt83 UTSW 15 101487049 missense probably benign 0.18
R4721:Krt83 UTSW 15 101487982 missense probably damaging 1.00
R4784:Krt83 UTSW 15 101487956 missense probably damaging 1.00
R4987:Krt83 UTSW 15 101487009 missense probably benign
R5008:Krt83 UTSW 15 101491224 missense probably damaging 1.00
R5101:Krt83 UTSW 15 101487510 missense probably benign 0.14
R5367:Krt83 UTSW 15 101486994 missense probably damaging 1.00
R5516:Krt83 UTSW 15 101487121 nonsense probably null
R5949:Krt83 UTSW 15 101487595 missense probably damaging 0.99
R5972:Krt83 UTSW 15 101487586 missense probably benign
R6036:Krt83 UTSW 15 101487531 missense possibly damaging 0.78
R6036:Krt83 UTSW 15 101487531 missense possibly damaging 0.78
R6135:Krt83 UTSW 15 101487534 missense probably damaging 1.00
R7151:Krt83 UTSW 15 101489648 missense probably damaging 1.00
R7186:Krt83 UTSW 15 101487202 splice site probably null
R7297:Krt83 UTSW 15 101489647 missense probably benign 0.42
R7708:Krt83 UTSW 15 101487932 missense probably benign 0.00
R7796:Krt83 UTSW 15 101485984 missense possibly damaging 0.95
R8172:Krt83 UTSW 15 101485403 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CTAGAAGCAGCCTCTTGCCTTGTTC -3'
(R):5'- AGCCTGACCACTGTGCATCTTG -3'

Sequencing Primer
(F):5'- TTCACATGGGTCAGCCTGAG -3'
(R):5'- ACATCCATTGTGCTCACTGG -3'
Posted On2014-01-05