Incidental Mutation 'R1117:Ccr4'
ID 97430
Institutional Source Beutler Lab
Gene Symbol Ccr4
Ensembl Gene ENSMUSG00000047898
Gene Name chemokine (C-C motif) receptor 4
Synonyms CC CKR-4, Cmkbr4
MMRRC Submission 039190-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1117 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 114490316-114504916 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 114492017 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 327 (V327M)
Ref Sequence ENSEMBL: ENSMUSP00000150002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054414] [ENSMUST00000215425] [ENSMUST00000215959]
AlphaFold P51680
Predicted Effect probably benign
Transcript: ENSMUST00000054414
AA Change: V327M

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000062677
Gene: ENSMUSG00000047898
AA Change: V327M

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 50 319 2.9e-11 PFAM
Pfam:7tm_1 56 304 3.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215425
AA Change: V327M

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000215959
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G-protein-coupled receptor family . It is a receptor for the CC chemokine - MIP-1, RANTES, TARC and MCP-1. Chemokines are a group of small polypeptide, structurally related molecules that regulate cell trafficking of various types of leukocytes. The chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in decreased mortality, decreased tumor necrosis factor production, and decreased IL-1beta production following LPS administration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,508,623 T353I probably benign Het
Arpc1b T C 5: 145,125,754 V226A possibly damaging Het
Casz1 C A 4: 148,934,595 T451K probably damaging Het
Cntrl A G 2: 35,127,973 E465G probably damaging Het
Cpa1 A G 6: 30,645,261 D412G probably benign Het
Crispld1 T A 1: 17,749,622 N281K probably benign Het
Cul3 T C 1: 80,280,924 Q465R probably damaging Het
Cyp2c68 G A 19: 39,712,459 T305M probably damaging Het
Elp4 T C 2: 105,842,311 D143G probably benign Het
Etnppl A G 3: 130,634,563 I462M probably benign Het
Fmo4 A G 1: 162,803,663 V245A probably benign Het
Gm4076 A G 13: 85,127,318 noncoding transcript Het
Gm9573 T C 17: 35,620,028 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcnj15 G A 16: 95,295,625 M8I probably benign Het
Klk1b22 A T 7: 44,116,859 M255L probably benign Het
Mmrn1 T A 6: 60,976,325 I530K possibly damaging Het
Nid2 A C 14: 19,763,664 probably null Het
Olfr311 A G 11: 58,841,815 K234E possibly damaging Het
Olfr63 C T 17: 33,268,966 R81* probably null Het
Olfr981 T C 9: 40,022,762 F123S probably damaging Het
Peak1 G A 9: 56,258,418 T742M probably benign Het
Sel1l3 T A 5: 53,172,607 T469S probably benign Het
Sez6 A G 11: 77,974,514 Y659C probably damaging Het
Slc19a2 A T 1: 164,263,456 I278F possibly damaging Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Tcerg1 A G 18: 42,574,652 D1079G probably damaging Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Umod T C 7: 119,477,306 N79S possibly damaging Het
Wdr43 A G 17: 71,616,387 T43A probably benign Het
Other mutations in Ccr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02625:Ccr4 APN 9 114492333 missense probably damaging 1.00
kentucky UTSW 9 114492646 missense probably damaging 1.00
P4748:Ccr4 UTSW 9 114492838 missense probably damaging 1.00
PIT4651001:Ccr4 UTSW 9 114492193 missense probably benign 0.08
R1542:Ccr4 UTSW 9 114492005 missense probably benign
R1954:Ccr4 UTSW 9 114492685 missense probably damaging 0.99
R2047:Ccr4 UTSW 9 114492565 missense probably damaging 1.00
R3157:Ccr4 UTSW 9 114492282 missense probably benign 0.04
R3158:Ccr4 UTSW 9 114492282 missense probably benign 0.04
R3159:Ccr4 UTSW 9 114492282 missense probably benign 0.04
R4868:Ccr4 UTSW 9 114492833 missense probably benign
R5051:Ccr4 UTSW 9 114492646 missense probably damaging 1.00
R6102:Ccr4 UTSW 9 114496493 splice site probably null
R6475:Ccr4 UTSW 9 114492979 missense probably benign 0.00
R6661:Ccr4 UTSW 9 114495963 intron probably benign
R7241:Ccr4 UTSW 9 114492956 missense probably benign
R7394:Ccr4 UTSW 9 114491926 missense probably benign
R8379:Ccr4 UTSW 9 114492167 missense probably benign 0.00
R8683:Ccr4 UTSW 9 114492148 missense probably damaging 1.00
R8746:Ccr4 UTSW 9 114492850 missense probably damaging 1.00
R8902:Ccr4 UTSW 9 114496552 intron probably benign
Z1177:Ccr4 UTSW 9 114492839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCACGGACATTTCAACCGATG -3'
(R):5'- ACGTGGTGCTTTTCCTGGAGAC -3'

Sequencing Primer
(F):5'- CTCAAGGGCTCATTGTCATGAAG -3'
(R):5'- CTTTTCCTGGAGACGCTGG -3'
Posted On 2014-01-05