Incidental Mutation 'R1117:Cyp2c68'
ID 97468
Institutional Source Beutler Lab
Gene Symbol Cyp2c68
Ensembl Gene ENSMUSG00000074882
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 68
Synonyms 9030012A22Rik
MMRRC Submission 039190-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1117 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 39688834-39741054 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 39712459 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 305 (T305M)
Ref Sequence ENSEMBL: ENSMUSP00000097071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099472]
AlphaFold K7N6C2
Predicted Effect probably damaging
Transcript: ENSMUST00000099472
AA Change: T305M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097071
Gene: ENSMUSG00000074882
AA Change: T305M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 2.1e-150 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,508,623 T353I probably benign Het
Arpc1b T C 5: 145,125,754 V226A possibly damaging Het
Casz1 C A 4: 148,934,595 T451K probably damaging Het
Ccr4 C T 9: 114,492,017 V327M probably benign Het
Cntrl A G 2: 35,127,973 E465G probably damaging Het
Cpa1 A G 6: 30,645,261 D412G probably benign Het
Crispld1 T A 1: 17,749,622 N281K probably benign Het
Cul3 T C 1: 80,280,924 Q465R probably damaging Het
Elp4 T C 2: 105,842,311 D143G probably benign Het
Etnppl A G 3: 130,634,563 I462M probably benign Het
Fmo4 A G 1: 162,803,663 V245A probably benign Het
Gm4076 A G 13: 85,127,318 noncoding transcript Het
Gm9573 T C 17: 35,620,028 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcnj15 G A 16: 95,295,625 M8I probably benign Het
Klk1b22 A T 7: 44,116,859 M255L probably benign Het
Mmrn1 T A 6: 60,976,325 I530K possibly damaging Het
Nid2 A C 14: 19,763,664 probably null Het
Olfr311 A G 11: 58,841,815 K234E possibly damaging Het
Olfr63 C T 17: 33,268,966 R81* probably null Het
Olfr981 T C 9: 40,022,762 F123S probably damaging Het
Peak1 G A 9: 56,258,418 T742M probably benign Het
Sel1l3 T A 5: 53,172,607 T469S probably benign Het
Sez6 A G 11: 77,974,514 Y659C probably damaging Het
Slc19a2 A T 1: 164,263,456 I278F possibly damaging Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Tcerg1 A G 18: 42,574,652 D1079G probably damaging Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Umod T C 7: 119,477,306 N79S possibly damaging Het
Wdr43 A G 17: 71,616,387 T43A probably benign Het
Other mutations in Cyp2c68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Cyp2c68 APN 19 39712495 missense probably damaging 0.98
IGL00826:Cyp2c68 APN 19 39739505 missense possibly damaging 0.87
IGL01363:Cyp2c68 APN 19 39703427 missense probably benign 0.01
IGL01892:Cyp2c68 APN 19 39734344 missense probably benign 0.00
IGL02088:Cyp2c68 APN 19 39703521 splice site probably benign
IGL02422:Cyp2c68 APN 19 39734452 missense probably damaging 1.00
IGL03047:Cyp2c68 UTSW 19 39734460 missense probably benign 0.00
R0523:Cyp2c68 UTSW 19 39739429 missense probably benign 0.08
R0729:Cyp2c68 UTSW 19 39739550 splice site probably benign
R0975:Cyp2c68 UTSW 19 39703358 missense possibly damaging 0.85
R1355:Cyp2c68 UTSW 19 39740956 missense probably damaging 1.00
R1370:Cyp2c68 UTSW 19 39740956 missense probably damaging 1.00
R1436:Cyp2c68 UTSW 19 39741040 start codon destroyed probably null 1.00
R1564:Cyp2c68 UTSW 19 39735580 nonsense probably null
R1730:Cyp2c68 UTSW 19 39699275 missense possibly damaging 0.87
R1865:Cyp2c68 UTSW 19 39734289 missense probably benign 0.04
R1905:Cyp2c68 UTSW 19 39735582 missense probably benign 0.01
R1951:Cyp2c68 UTSW 19 39712528 missense probably benign 0.22
R1952:Cyp2c68 UTSW 19 39712528 missense probably benign 0.22
R2224:Cyp2c68 UTSW 19 39735582 missense probably benign 0.34
R2230:Cyp2c68 UTSW 19 39699360 missense probably benign 0.07
R2231:Cyp2c68 UTSW 19 39699360 missense probably benign 0.07
R2866:Cyp2c68 UTSW 19 39689145 missense probably damaging 1.00
R3104:Cyp2c68 UTSW 19 39734313 missense probably benign
R4409:Cyp2c68 UTSW 19 39739452 missense probably damaging 0.98
R4575:Cyp2c68 UTSW 19 39734361 missense probably benign 0.21
R4620:Cyp2c68 UTSW 19 39712562 splice site probably null
R4684:Cyp2c68 UTSW 19 39699335 missense possibly damaging 0.48
R5023:Cyp2c68 UTSW 19 39712507 missense probably benign 0.01
R5410:Cyp2c68 UTSW 19 39699284 missense possibly damaging 0.65
R5513:Cyp2c68 UTSW 19 39703406 missense probably damaging 1.00
R5568:Cyp2c68 UTSW 19 39689082 missense probably benign 0.19
R5706:Cyp2c68 UTSW 19 39734318 missense possibly damaging 0.95
R5890:Cyp2c68 UTSW 19 39712492 missense probably damaging 1.00
R5897:Cyp2c68 UTSW 19 39712531 missense probably benign 0.01
R6007:Cyp2c68 UTSW 19 39734336 missense probably damaging 1.00
R6132:Cyp2c68 UTSW 19 39703414 missense possibly damaging 0.90
R6187:Cyp2c68 UTSW 19 39741008 missense probably benign 0.32
R6229:Cyp2c68 UTSW 19 39739178 missense probably benign 0.02
R6341:Cyp2c68 UTSW 19 39712489 missense possibly damaging 0.54
R7209:Cyp2c68 UTSW 19 39689205 missense probably damaging 1.00
R7330:Cyp2c68 UTSW 19 39689190 missense probably damaging 1.00
R7374:Cyp2c68 UTSW 19 39739204 critical splice acceptor site probably null
R7402:Cyp2c68 UTSW 19 39740874 missense probably benign 0.02
R7483:Cyp2c68 UTSW 19 39689137 missense probably benign 0.02
R9103:Cyp2c68 UTSW 19 39739181 missense possibly damaging 0.95
R9204:Cyp2c68 UTSW 19 39739127 missense probably damaging 1.00
Z1088:Cyp2c68 UTSW 19 39739463 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GATGCTTAGAACAGACCACCTGCC -3'
(R):5'- GACCATCTACACCACAGTCTCTGAAATG -3'

Sequencing Primer
(F):5'- TCAAACAAAGGACTGGCCTTG -3'
(R):5'- CCACAGTCTCTGAAATGGTATAAATG -3'
Posted On 2014-01-05