Incidental Mutation 'R1298:H6pd'
ID158207
Institutional Source Beutler Lab
Gene Symbol H6pd
Ensembl Gene ENSMUSG00000028980
Gene Namehexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
SynonymsGpd-1, Gpd1, G6pd1
MMRRC Submission 039364-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R1298 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location149979475-150009023 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 149982514 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 472 (I472V)
Ref Sequence ENSEMBL: ENSMUSP00000081134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030830] [ENSMUST00000084117]
Predicted Effect probably benign
Transcript: ENSMUST00000030830
AA Change: I480V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000030830
Gene: ENSMUSG00000028980
AA Change: I480V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:G6PD_N 34 218 1.6e-41 PFAM
Pfam:G6PD_C 220 523 3.2e-58 PFAM
Pfam:Glucosamine_iso 564 788 8.2e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084117
AA Change: I472V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000081134
Gene: ENSMUSG00000028980
AA Change: I472V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:G6PD_N 26 210 8.6e-39 PFAM
Pfam:G6PD_C 212 387 3.6e-42 PFAM
Pfam:Glucosamine_iso 561 758 9.9e-62 PFAM
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are 2 forms of glucose-6-phosphate dehydrogenase. G form is X-linked and H form, encoded by this gene, is autosomally linked. This H form shows activity with other hexose-6-phosphates, especially galactose-6-phosphate, whereas the G form is specific for glucose-6-phosphate. Both forms are present in most tissues, but H form is not found in red cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show enlarged adrenal glands, reduced plasma corticosterone levels and altered 11 beta-hydroxysteroid dehydrogenase type 1 enzyme activity. Treatment with 11-dehydrocorticosterone fails to inhibit glucose-stimulatedinsulin secretion in pancreatic islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A G 6: 116,427,264 W145R probably damaging Het
Aspm T A 1: 139,457,419 V267D probably benign Het
Bbs4 A T 9: 59,339,813 W135R probably damaging Het
Cavin4 T C 4: 48,672,593 V346A probably benign Het
Cdk18 A C 1: 132,122,451 probably benign Het
Cyp2j11 C T 4: 96,307,260 probably null Het
Dnah6 A T 6: 73,159,135 I1007K probably damaging Het
Dnmt1 T C 9: 20,941,456 E118G probably benign Het
Eef2 C CN 10: 81,178,768 probably null Het
Gm14496 T C 2: 181,996,092 F320L probably benign Het
Gm2046 T A 12: 87,980,083 D98E probably benign Het
Gsdmc3 A T 15: 63,860,281 L299M probably damaging Het
Hao2 G T 3: 98,883,669 T63K possibly damaging Het
Jag2 C T 12: 112,916,319 probably benign Het
Mapre3 A G 5: 30,864,867 Y211C probably damaging Het
Mycbp2 A G 14: 103,155,898 S2966P probably damaging Het
Nsd3 T A 8: 25,679,936 V696E possibly damaging Het
Obscn A G 11: 59,054,897 Y4163H possibly damaging Het
Olfr1120 G A 2: 87,358,070 A209T probably benign Het
Olfr747 A T 14: 50,680,880 Y251* probably null Het
Olfr788 G T 10: 129,473,064 C124F probably damaging Het
Pde2a A G 7: 101,507,202 E607G probably benign Het
Pinlyp T A 7: 24,544,966 D51V probably damaging Het
Rcbtb2 T A 14: 73,162,388 I87N probably damaging Het
Sfswap A G 5: 129,541,378 I459V probably benign Het
Slitrk6 T C 14: 110,751,865 N137D possibly damaging Het
Smg1 A T 7: 118,168,211 probably benign Het
Sobp T A 10: 43,022,335 H418L probably damaging Het
Spock1 A C 13: 57,512,750 D180E probably benign Het
Upk3a G A 15: 85,020,551 V167I probably benign Het
Vmn1r180 T C 7: 23,953,147 V245A possibly damaging Het
Zbtb25 T C 12: 76,350,001 E149G probably benign Het
Zgrf1 T C 3: 127,583,889 C44R possibly damaging Het
Other mutations in H6pd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:H6pd APN 4 149994468 critical splice donor site probably null
IGL01450:H6pd APN 4 149984118 missense probably damaging 1.00
IGL01913:H6pd APN 4 149994463 unclassified probably benign
IGL01914:H6pd APN 4 149994463 unclassified probably benign
dryer UTSW 4 149982865 missense probably damaging 1.00
herr UTSW 4 149983902 critical splice donor site probably null
R0402:H6pd UTSW 4 149996316 missense probably damaging 1.00
R0486:H6pd UTSW 4 149982936 splice site probably benign
R0548:H6pd UTSW 4 149981616 missense probably damaging 1.00
R0690:H6pd UTSW 4 149982573 missense possibly damaging 0.93
R1165:H6pd UTSW 4 149995956 missense possibly damaging 0.95
R1331:H6pd UTSW 4 149982415 missense probably benign 0.28
R1581:H6pd UTSW 4 149982514 missense possibly damaging 0.94
R1781:H6pd UTSW 4 149995931 missense probably damaging 1.00
R1791:H6pd UTSW 4 149981673 missense probably damaging 0.97
R1840:H6pd UTSW 4 149982050 missense possibly damaging 0.55
R2290:H6pd UTSW 4 149981881 missense probably damaging 1.00
R3889:H6pd UTSW 4 149995773 missense possibly damaging 0.67
R4432:H6pd UTSW 4 149995758 missense probably damaging 1.00
R4576:H6pd UTSW 4 149994476 missense probably damaging 0.99
R4629:H6pd UTSW 4 149996346 missense probably benign 0.10
R4856:H6pd UTSW 4 149982778 missense possibly damaging 0.47
R4886:H6pd UTSW 4 149982778 missense possibly damaging 0.47
R4951:H6pd UTSW 4 149981587 missense probably damaging 1.00
R5124:H6pd UTSW 4 149982055 missense possibly damaging 0.57
R5337:H6pd UTSW 4 149981784 missense probably benign 0.02
R5408:H6pd UTSW 4 149982865 missense probably damaging 1.00
R5474:H6pd UTSW 4 149996089 missense probably damaging 1.00
R6266:H6pd UTSW 4 149995957 missense probably benign 0.32
R6476:H6pd UTSW 4 149982727 missense probably damaging 0.99
R6725:H6pd UTSW 4 149996358 missense probably damaging 1.00
R6733:H6pd UTSW 4 149985121 splice site probably null
R6785:H6pd UTSW 4 149982790 missense possibly damaging 0.50
R6853:H6pd UTSW 4 149982462 missense probably benign 0.00
R6921:H6pd UTSW 4 149982051 missense probably damaging 0.99
R7258:H6pd UTSW 4 149996362 missense probably benign 0.09
R7269:H6pd UTSW 4 149982912 missense probably benign 0.00
R7326:H6pd UTSW 4 149996350 missense probably benign 0.00
R7348:H6pd UTSW 4 149983902 critical splice donor site probably null
R7488:H6pd UTSW 4 149982636 missense probably benign
R7512:H6pd UTSW 4 149995948 missense probably benign 0.00
R7684:H6pd UTSW 4 149996062 missense probably benign
R7704:H6pd UTSW 4 149982903 missense probably benign 0.45
R7954:H6pd UTSW 4 149982826 missense probably benign
R8226:H6pd UTSW 4 149995989 missense probably benign 0.02
X0020:H6pd UTSW 4 149982798 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTTGCCGAAGTGCCGTACTG -3'
(R):5'- TCAGCCGGAACCTGTTCAAACC -3'

Sequencing Primer
(F):5'- AATCAGTGGGCTCTGTCTATAC -3'
(R):5'- GGAACCTGTTCAAACCCTCAC -3'
Posted On2014-02-18