Incidental Mutation 'R1446:Aasdh'
ID158859
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Nameaminoadipate-semialdehyde dehydrogenase
SynonymsA230062G08Rik
MMRRC Submission 039501-MU
Accession Numbers

Genbank: NM_173765.3; Ensembl: ENSMUST00000120963

Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R1446 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location76873659-76905514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76886289 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 472 (A472T)
Ref Sequence ENSEMBL: ENSMUSP00000117639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120963] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000146570] [ENSMUST00000149602]
Predicted Effect probably benign
Transcript: ENSMUST00000069709
AA Change: A472T

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: A472T

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000120963
AA Change: A472T

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: A472T

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123059
Predicted Effect probably benign
Transcript: ENSMUST00000123682
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126741
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135697
Predicted Effect probably benign
Transcript: ENSMUST00000146570
AA Change: A472T

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117639
Gene: ENSMUSG00000055923
AA Change: A472T

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 2.1e-58 PFAM
Pfam:PP-binding 556 628 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149602
SMART Domains Protein: ENSMUSP00000117489
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
PQQ 21 53 4.37e-2 SMART
PQQ 63 95 2.3e1 SMART
Blast:PQQ 104 130 2e-6 BLAST
PQQ 141 173 2.61e2 SMART
low complexity region 191 200 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A T 14: 55,770,023 probably null Het
Ahcyl2 T C 6: 29,891,240 S448P probably damaging Het
Anks1b A G 10: 90,511,073 Y745C probably benign Het
Anxa1 A T 19: 20,373,739 L339Q probably damaging Het
Apoa4 A G 9: 46,242,293 D64G probably benign Het
Arpc1a A G 5: 145,101,086 probably null Het
Bank1 C T 3: 136,064,143 G727R probably damaging Het
Best2 T C 8: 85,007,964 Q375R probably benign Het
Cacna1b T A 2: 24,706,177 M501L probably benign Het
Col27a1 T A 4: 63,224,803 Y243N probably damaging Het
Cyp11a1 A T 9: 58,015,277 Q80L possibly damaging Het
Dnah10 T A 5: 124,789,796 W2260R probably damaging Het
Dnajc19 T C 3: 34,057,979 H139R probably benign Het
Dppa5a T A 9: 78,367,789 N77I probably benign Het
Edc4 T C 8: 105,888,132 S125P probably damaging Het
Eid2 T C 7: 28,268,589 I212T possibly damaging Het
Fam234b T A 6: 135,209,330 probably null Het
Frem2 T C 3: 53,654,596 E830G probably benign Het
Fyb A T 15: 6,652,466 I765L probably benign Het
Fyn T G 10: 39,522,779 S124A probably benign Het
Gal3st3 T A 19: 5,306,911 F105I probably damaging Het
Gm13762 A G 2: 88,973,765 I42T probably benign Het
Gpr146 A G 5: 139,393,422 I326M probably benign Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Gsn A G 2: 35,306,586 K669R probably benign Het
H2-T10 A T 17: 36,119,374 I225N possibly damaging Het
Il12rb2 T C 6: 67,309,143 H106R probably benign Het
Kat14 A G 2: 144,373,718 E41G probably damaging Het
Kcnma1 G T 14: 23,311,724 T1006K probably damaging Het
Kif18b G A 11: 102,914,699 T244I probably damaging Het
Klb A T 5: 65,348,995 H195L probably damaging Het
Lrriq4 T C 3: 30,650,578 F252L probably benign Het
Lum C T 10: 97,568,390 T49I possibly damaging Het
Map3k4 T A 17: 12,256,794 L84* probably null Het
Mindy2 A G 9: 70,607,456 probably null Het
Mpped2 G T 2: 106,783,732 R137L possibly damaging Het
Myo18b G A 5: 112,757,559 R2058W probably damaging Het
Nol8 T A 13: 49,655,227 L65Q probably damaging Het
Olfr1009 A G 2: 85,721,573 H56R probably damaging Het
Olfr1269 A T 2: 90,118,858 L247M probably damaging Het
Olfr1458 G A 19: 13,103,016 A96V possibly damaging Het
Olfr147 T G 9: 38,403,305 C144G possibly damaging Het
Olfr460 C T 6: 40,571,899 S171L probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Parp12 G T 6: 39,102,561 D338E probably benign Het
Pde6d T C 1: 86,546,692 E77G probably damaging Het
Phkg1 A C 5: 129,873,214 probably null Het
Pigw A C 11: 84,878,360 S48A probably benign Het
Pkm T A 9: 59,668,910 probably null Het
Ppp1r3f G A X: 7,560,363 T553M probably damaging Het
Retreg2 T A 1: 75,143,459 F44L possibly damaging Het
Ryr2 A T 13: 11,738,149 M1762K probably benign Het
Sec16a A G 2: 26,423,567 V1927A probably benign Het
Sec23a G T 12: 58,978,559 A492E probably damaging Het
Skint4 T A 4: 112,118,114 H82Q probably benign Het
Srbd1 T C 17: 86,139,152 K60E probably benign Het
Stk24 A G 14: 121,308,044 Y101H probably damaging Het
Sult1e1 A T 5: 87,578,537 N239K probably damaging Het
Tgs1 C T 4: 3,604,848 P757S probably damaging Het
Tmc2 A T 2: 130,248,730 E665D probably damaging Het
Tmprss15 C A 16: 79,078,958 D163Y probably benign Het
Unc13a C A 8: 71,648,981 V1009L possibly damaging Het
Unc45b G T 11: 82,928,670 G490C probably damaging Het
Vmn1r177 T A 7: 23,866,340 H37L probably damaging Het
Vwa5a A G 9: 38,733,968 M450V possibly damaging Het
Wars2 T C 3: 99,187,527 I46T probably benign Het
Wdfy3 G T 5: 101,851,310 T3098K possibly damaging Het
Zan A T 5: 137,389,360 I4863N unknown Het
Zfp616 A G 11: 74,083,238 probably null Het
Zfp770 A T 2: 114,197,033 I185N probably damaging Het
Zfp808 T G 13: 62,173,007 H683Q probably damaging Het
Zmym4 A T 4: 126,882,482 W1221R probably damaging Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 76878534 unclassified probably benign
IGL01013:Aasdh APN 5 76886206 missense possibly damaging 0.68
IGL01558:Aasdh APN 5 76888617 missense possibly damaging 0.89
IGL02544:Aasdh APN 5 76902114 missense probably benign 0.27
IGL02614:Aasdh APN 5 76896368 splice site probably benign
IGL02678:Aasdh APN 5 76888020 splice site probably benign
IGL02739:Aasdh APN 5 76878517 missense possibly damaging 0.64
IGL02947:Aasdh APN 5 76902110 missense probably benign 0.01
IGL03116:Aasdh APN 5 76902089 splice site probably null
IGL03398:Aasdh APN 5 76891719 missense probably benign 0.02
1mM(1):Aasdh UTSW 5 76896617 missense possibly damaging 0.91
R0183:Aasdh UTSW 5 76886235 missense probably benign 0.05
R0226:Aasdh UTSW 5 76902002 missense probably damaging 1.00
R0367:Aasdh UTSW 5 76902114 missense probably damaging 0.99
R0386:Aasdh UTSW 5 76896461 missense probably damaging 0.98
R0529:Aasdh UTSW 5 76876267 nonsense probably null
R0881:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R0882:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1033:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1034:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1035:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1036:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1366:Aasdh UTSW 5 76888804 missense probably benign 0.10
R1449:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1583:Aasdh UTSW 5 76882681 missense probably benign 0.00
R1641:Aasdh UTSW 5 76891779 missense probably benign 0.36
R1876:Aasdh UTSW 5 76877549 missense probably damaging 1.00
R1895:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R1946:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R3615:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3616:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3746:Aasdh UTSW 5 76888654 nonsense probably null
R3747:Aasdh UTSW 5 76888654 nonsense probably null
R3748:Aasdh UTSW 5 76888654 nonsense probably null
R3750:Aasdh UTSW 5 76888654 nonsense probably null
R3836:Aasdh UTSW 5 76878468 missense probably benign 0.32
R4857:Aasdh UTSW 5 76887284 missense probably benign 0.01
R4928:Aasdh UTSW 5 76896688 missense possibly damaging 0.65
R4937:Aasdh UTSW 5 76888654 nonsense probably null
R5762:Aasdh UTSW 5 76896598 missense probably benign 0.00
R5866:Aasdh UTSW 5 76876211 missense probably damaging 1.00
R5940:Aasdh UTSW 5 76882898 missense probably benign 0.07
R6253:Aasdh UTSW 5 76886258 missense possibly damaging 0.81
R6542:Aasdh UTSW 5 76883055 missense probably damaging 1.00
R6825:Aasdh UTSW 5 76888849 splice site probably null
R6868:Aasdh UTSW 5 76891680 missense probably damaging 0.99
R6876:Aasdh UTSW 5 76896441 missense probably damaging 1.00
R6961:Aasdh UTSW 5 76876301 missense probably damaging 1.00
R6963:Aasdh UTSW 5 76896456 missense probably damaging 0.99
R7069:Aasdh UTSW 5 76876356 missense probably benign 0.03
R7220:Aasdh UTSW 5 76901925 missense probably benign 0.13
R7545:Aasdh UTSW 5 76880014 missense probably damaging 1.00
R7673:Aasdh UTSW 5 76882708 missense probably benign 0.03
R7703:Aasdh UTSW 5 76888077 missense probably damaging 0.99
R7890:Aasdh UTSW 5 76884122 missense probably benign 0.19
R7978:Aasdh UTSW 5 76888668 missense probably damaging 0.99
R8046:Aasdh UTSW 5 76896478 missense probably benign
R8152:Aasdh UTSW 5 76896458 missense probably damaging 1.00
R8425:Aasdh UTSW 5 76886277 missense possibly damaging 0.49
Z1088:Aasdh UTSW 5 76901157 splice site probably null
Z1176:Aasdh UTSW 5 76891796 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACACCGCTTTGTCGCTTTACCAT -3'
(R):5'- TTGGCATTGTCTAAAGCTGACACCTT -3'

Sequencing Primer
(F):5'- CATGGCATGTAAATGGCAGG -3'
(R):5'- tcactgctctttcagaggac -3'
Posted On2014-03-14