Incidental Mutation 'R1422:Coro2b'
ID161127
Institutional Source Beutler Lab
Gene Symbol Coro2b
Ensembl Gene ENSMUSG00000041729
Gene Namecoronin, actin binding protein, 2B
Synonyms
MMRRC Submission 039478-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R1422 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location62419492-62537044 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 62428947 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048043] [ENSMUST00000164246] [ENSMUST00000173171] [ENSMUST00000174439]
Predicted Effect probably null
Transcript: ENSMUST00000048043
SMART Domains Protein: ENSMUSP00000041826
Gene: ENSMUSG00000041729

DomainStartEndE-ValueType
DUF1899 10 74 2.89e-31 SMART
WD40 73 116 8.75e-5 SMART
WD40 126 166 4.95e-4 SMART
WD40 169 208 1.33e-4 SMART
WD40 211 254 2.56e1 SMART
DUF1900 261 397 1.62e-84 SMART
coiled coil region 436 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131981
SMART Domains Protein: ENSMUSP00000133481
Gene: ENSMUSG00000041729

DomainStartEndE-ValueType
DUF1900 3 97 6.37e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151604
Predicted Effect probably null
Transcript: ENSMUST00000164246
SMART Domains Protein: ENSMUSP00000128441
Gene: ENSMUSG00000041729

DomainStartEndE-ValueType
DUF1899 5 69 2.89e-31 SMART
WD40 68 111 8.75e-5 SMART
WD40 121 161 4.95e-4 SMART
WD40 164 203 1.33e-4 SMART
WD40 206 249 2.56e1 SMART
DUF1900 256 317 5.33e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173171
SMART Domains Protein: ENSMUSP00000134709
Gene: ENSMUSG00000041729

DomainStartEndE-ValueType
DUF1899 16 80 2.89e-31 SMART
Pfam:WD40 87 121 1.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174439
SMART Domains Protein: ENSMUSP00000134079
Gene: ENSMUSG00000041729

DomainStartEndE-ValueType
WD40 1 41 4.95e-4 SMART
WD40 44 83 1.33e-4 SMART
Meta Mutation Damage Score 0.9498 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.6%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Homozygous knockout reduces susceptibility to Doxorubicin-induced focal segmental glomerulosclerosis with lower levels of proteinuria and less renal glomerulus damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
4931408C20Rik C G 1: 26,682,466 S1211T possibly damaging Het
Arhgap5 T A 12: 52,519,514 D1089E probably damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Becn1 T C 11: 101,295,126 D98G possibly damaging Het
Cpne4 T C 9: 104,900,285 I143T probably damaging Het
Cr2 A G 1: 195,171,125 I35T probably benign Het
Ctns T C 11: 73,185,246 Y321C probably damaging Het
Cyp4f16 A T 17: 32,542,999 M174L probably damaging Het
Dpy19l4 T C 4: 11,317,168 E10G possibly damaging Het
Dtx3 T A 10: 127,191,289 I339F possibly damaging Het
Fam184a A T 10: 53,675,208 M625K probably benign Het
Fgd6 A G 10: 94,045,372 E696G probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gria1 T A 11: 57,189,788 L199Q probably benign Het
Hk1 T C 10: 62,296,094 D184G probably null Het
Ift88 T C 14: 57,438,301 probably benign Het
Ift88 G A 14: 57,472,979 V403M probably damaging Het
Igsf1 C A X: 49,782,936 G737* probably null Het
Kif19a A G 11: 114,785,809 D488G probably benign Het
Lpcat2 T C 8: 92,879,417 L232P probably damaging Het
Ly9 A G 1: 171,601,212 V280A probably damaging Het
Macrod2 T A 2: 140,419,941 probably null Het
Mmp1a A G 9: 7,464,298 probably null Het
Mmrn2 A G 14: 34,396,239 H80R probably damaging Het
Olfr1156 G A 2: 87,950,095 T46I probably benign Het
Olfr124 T C 17: 37,805,363 Y73H probably damaging Het
Olfr564 G A 7: 102,803,850 R124H probably benign Het
Pkd1l3 C A 8: 109,621,708 P194H unknown Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Pms2 T A 5: 143,913,705 S113T probably damaging Het
Ptprk A G 10: 28,475,280 I590V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad17 A G 13: 100,645,082 L69P probably benign Het
Robo2 G A 16: 73,978,448 T466M probably damaging Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Slc6a19 A G 13: 73,685,869 S357P probably benign Het
Spock3 T C 8: 63,143,989 I109T possibly damaging Het
Svs6 T C 2: 164,317,660 probably null Het
Tenm4 A T 7: 96,550,051 D17V probably damaging Het
Trp53bp2 T A 1: 182,446,464 M558K probably benign Het
Ttn T C 2: 76,741,670 E26293G probably damaging Het
Vmn1r29 A G 6: 58,307,886 Y197C probably damaging Het
Wdfy3 A T 5: 101,884,214 probably benign Het
Zfp366 A G 13: 99,229,296 K322E probably damaging Het
Other mutations in Coro2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01772:Coro2b APN 9 62425808 missense probably damaging 0.99
IGL01834:Coro2b APN 9 62431357 missense possibly damaging 0.93
IGL03242:Coro2b APN 9 62428961 nonsense probably null
PIT4151001:Coro2b UTSW 9 62429004 missense probably damaging 1.00
R0422:Coro2b UTSW 9 62427977 missense probably benign 0.00
R0835:Coro2b UTSW 9 62425837 missense possibly damaging 0.68
R0944:Coro2b UTSW 9 62427981 missense probably benign 0.08
R1115:Coro2b UTSW 9 62431327 missense probably damaging 0.96
R1254:Coro2b UTSW 9 62428965 missense probably damaging 0.98
R1532:Coro2b UTSW 9 62489423 missense probably damaging 1.00
R1543:Coro2b UTSW 9 62425841 missense probably benign 0.32
R3424:Coro2b UTSW 9 62429308 splice site probably null
R3971:Coro2b UTSW 9 62429240 missense possibly damaging 0.55
R3972:Coro2b UTSW 9 62429240 missense possibly damaging 0.55
R4035:Coro2b UTSW 9 62425789 unclassified probably benign
R4233:Coro2b UTSW 9 62426185 missense possibly damaging 0.69
R4734:Coro2b UTSW 9 62426578 missense probably benign 0.02
R4825:Coro2b UTSW 9 62454623 missense probably benign 0.30
R5332:Coro2b UTSW 9 62429230 missense probably damaging 0.97
R5702:Coro2b UTSW 9 62426577 missense probably damaging 0.97
R6474:Coro2b UTSW 9 62426628 missense probably benign 0.16
R6500:Coro2b UTSW 9 62489324 missense probably benign 0.24
R6674:Coro2b UTSW 9 62432427 missense probably damaging 1.00
R7102:Coro2b UTSW 9 62421385 missense possibly damaging 0.81
R7347:Coro2b UTSW 9 62489372 missense probably benign
R8199:Coro2b UTSW 9 62429020 missense probably benign 0.00
R8447:Coro2b UTSW 9 62426560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAAGGCCACATTGGAAGATCTC -3'
(R):5'- TTCTTAGATGCAGCCTGACCAACAC -3'

Sequencing Primer
(F):5'- AACTTGTCCCGAAAGGAGTTCTC -3'
(R):5'- CCAACCTCCTCCCTACAGG -3'
Posted On2014-03-14