Incidental Mutation 'R1481:Olfr498'
ID 164372
Institutional Source Beutler Lab
Gene Symbol Olfr498
Ensembl Gene ENSMUSG00000096679
Gene Name olfactory receptor 498
Synonyms MOR204-36, GA_x6K02T2PBJ9-10795522-10796514
MMRRC Submission 039534-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R1481 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 108465326-108467585 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 108465960 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 212 (T212I)
Ref Sequence ENSEMBL: ENSMUSP00000150971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000217616]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000074787
AA Change: T212I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074343
Gene: ENSMUSG00000096679
AA Change: T212I

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.7e-51 PFAM
Pfam:7tm_1 44 293 5.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217616
AA Change: T212I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,008,434 V3365A probably damaging Het
Arhgef5 A G 6: 43,274,634 H773R probably damaging Het
Bmp3 G A 5: 98,872,470 V251M probably damaging Het
Ccdc175 C A 12: 72,101,948 probably benign Het
Ccdc178 C T 18: 22,105,621 G313D probably benign Het
Cd300ld2 T A 11: 115,012,633 I129F probably benign Het
Cep170 T C 1: 176,782,385 Q120R possibly damaging Het
Ckb T C 12: 111,671,262 H145R probably benign Het
Cntnap5a T A 1: 116,117,663 N336K probably damaging Het
Coil T A 11: 88,974,060 C38S possibly damaging Het
Cps1 T C 1: 67,143,882 V133A probably damaging Het
Cspg4 A G 9: 56,887,810 E943G probably damaging Het
Cyp2c54 C T 19: 40,047,588 D293N probably benign Het
Cyp2f2 T C 7: 27,121,877 S72P probably benign Het
Dip2c G A 13: 9,551,866 probably null Het
Dock6 T C 9: 21,820,622 T1158A probably benign Het
Dscaml1 G A 9: 45,672,643 V469I probably benign Het
Efcab14 A G 4: 115,756,517 T221A probably benign Het
Ehbp1 T C 11: 22,006,782 *1207W probably null Het
Eln T C 5: 134,706,572 K786E probably damaging Het
Fyb C T 15: 6,619,647 P385S probably benign Het
Galr1 A G 18: 82,405,741 I137T possibly damaging Het
Gcm1 A T 9: 78,059,717 K73* probably null Het
Gemin5 T C 11: 58,141,654 N775D probably damaging Het
Gli3 C T 13: 15,613,850 H147Y probably damaging Het
Gm10754 G T 10: 97,682,227 probably benign Het
Gpr37 T C 6: 25,669,138 D569G probably damaging Het
Grina T A 15: 76,249,089 Y286N probably damaging Het
Gtf3c1 C A 7: 125,693,138 probably null Het
Kcnc4 C T 3: 107,448,218 V305M probably benign Het
Kntc1 T C 5: 123,778,275 F724L probably benign Het
Kpnb1 T C 11: 97,178,310 Y249C probably damaging Het
Krt6b T C 15: 101,678,374 T269A probably benign Het
Lamc1 T C 1: 153,221,634 K1555E probably damaging Het
Maneal T C 4: 124,861,857 Y104C probably damaging Het
Map1b T C 13: 99,431,171 T1681A unknown Het
Mettl17 T C 14: 51,890,703 L272P probably benign Het
Mib2 T A 4: 155,656,999 S357C probably benign Het
Mmp19 C A 10: 128,798,178 T316K possibly damaging Het
Mroh9 C T 1: 163,026,509 G774E probably damaging Het
Myh1 T C 11: 67,205,499 probably benign Het
Ncor2 C A 5: 125,027,138 E963* probably null Het
Nol6 T A 4: 41,123,596 T51S probably benign Het
Nsun3 A T 16: 62,735,369 C265S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Nutm2 T A 13: 50,469,481 N71K probably damaging Het
Olfr713 T G 7: 107,036,149 L5R probably benign Het
Orc3 T A 4: 34,607,228 E34V possibly damaging Het
Pcdhb13 T A 18: 37,442,836 L89Q probably damaging Het
Polr3a A T 14: 24,452,548 V1241E probably null Het
Prpf39 C T 12: 65,053,314 P135S probably damaging Het
Psrc1 T C 3: 108,384,993 V34A probably benign Het
Rab27a G A 9: 73,082,402 V52M probably benign Het
Rassf9 A G 10: 102,546,034 T424A probably benign Het
Ripor3 G T 2: 168,000,377 R61S possibly damaging Het
Ryr3 C T 2: 112,636,522 probably benign Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Setbp1 C T 18: 78,783,301 V1366M probably benign Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Tctn2 T C 5: 124,607,763 noncoding transcript Het
Tmem45a A T 16: 56,811,602 F218I possibly damaging Het
Tpte A T 8: 22,355,471 R512S probably damaging Het
Trim37 T A 11: 87,129,759 L22* probably null Het
Ttc6 A G 12: 57,737,130 N1792D probably damaging Het
Ttn A G 2: 76,945,616 M1694T probably damaging Het
Vmn1r181 T A 7: 23,984,712 W201R probably damaging Het
Wdr74 C T 19: 8,738,228 L198F possibly damaging Het
Zfp560 T C 9: 20,348,790 T259A probably benign Het
Other mutations in Olfr498
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03232:Olfr498 APN 7 108465605 missense probably benign 0.06
IGL03348:Olfr498 APN 7 108465408 missense probably benign
IGL03408:Olfr498 APN 7 108465347 missense probably damaging 1.00
IGL03047:Olfr498 UTSW 7 108465776 missense probably damaging 0.97
R0208:Olfr498 UTSW 7 108465543 missense probably damaging 1.00
R0363:Olfr498 UTSW 7 108465734 missense possibly damaging 0.81
R1886:Olfr498 UTSW 7 108465740 missense probably benign 0.39
R2065:Olfr498 UTSW 7 108465668 missense possibly damaging 0.69
R2103:Olfr498 UTSW 7 108465603 missense probably benign 0.03
R3731:Olfr498 UTSW 7 108465426 missense possibly damaging 0.88
R4763:Olfr498 UTSW 7 108466186 missense probably benign 0.34
R4839:Olfr498 UTSW 7 108465731 missense probably benign 0.03
R4997:Olfr498 UTSW 7 108465494 missense probably benign 0.01
R5533:Olfr498 UTSW 7 108466262 missense probably benign 0.00
R7286:Olfr498 UTSW 7 108465435 missense possibly damaging 0.52
R7910:Olfr498 UTSW 7 108465771 missense probably benign 0.01
R8005:Olfr498 UTSW 7 108465486 missense probably benign 0.01
R8487:Olfr498 UTSW 7 108465577 missense possibly damaging 0.69
R8976:Olfr498 UTSW 7 108465423 missense possibly damaging 0.87
R9097:Olfr498 UTSW 7 108465608 missense probably damaging 1.00
Z1088:Olfr498 UTSW 7 108465371 missense probably benign
Z1176:Olfr498 UTSW 7 108465371 missense probably benign
Z1177:Olfr498 UTSW 7 108465371 missense probably benign
Z1177:Olfr498 UTSW 7 108466021 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGTCACACCCAATATGCTTGCTACC -3'
(R):5'- AGCTGGACTTGGGCATCACATAAATG -3'

Sequencing Primer
(F):5'- TGTCCACAGAAGCCTGTATC -3'
(R):5'- TGGGCATCACATAAATGAATATAGC -3'
Posted On 2014-03-28