Mutagenetix > Incidental Mutation

Incidental Mutation 'R1481:Map1b'

164400

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

039534-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1481 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 99431171 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1681 (T1681A)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

unknown
Transcript: ENSMUST00000064762
AA Change: T1681A

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: T1681A

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223693

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224702

Meta Mutation Damage Score

0.1623

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 37,008,434	V3365A	probably damaging	Het
Arhgef5	A	G	6: 43,274,634	H773R	probably damaging	Het
Bmp3	G	A	5: 98,872,470	V251M	probably damaging	Het
Ccdc175	C	A	12: 72,101,948		probably benign	Het
Ccdc178	C	T	18: 22,105,621	G313D	probably benign	Het
Cd300ld2	T	A	11: 115,012,633	I129F	probably benign	Het
Cep170	T	C	1: 176,782,385	Q120R	possibly damaging	Het
Ckb	T	C	12: 111,671,262	H145R	probably benign	Het
Cntnap5a	T	A	1: 116,117,663	N336K	probably damaging	Het
Coil	T	A	11: 88,974,060	C38S	possibly damaging	Het
Cps1	T	C	1: 67,143,882	V133A	probably damaging	Het
Cspg4	A	G	9: 56,887,810	E943G	probably damaging	Het
Cyp2c54	C	T	19: 40,047,588	D293N	probably benign	Het
Cyp2f2	T	C	7: 27,121,877	S72P	probably benign	Het
Dip2c	G	A	13: 9,551,866		probably null	Het
Dock6	T	C	9: 21,820,622	T1158A	probably benign	Het
Dscaml1	G	A	9: 45,672,643	V469I	probably benign	Het
Efcab14	A	G	4: 115,756,517	T221A	probably benign	Het
Ehbp1	T	C	11: 22,006,782	*1207W	probably null	Het
Eln	T	C	5: 134,706,572	K786E	probably damaging	Het
Fyb	C	T	15: 6,619,647	P385S	probably benign	Het
Galr1	A	G	18: 82,405,741	I137T	possibly damaging	Het
Gcm1	A	T	9: 78,059,717	K73*	probably null	Het
Gemin5	T	C	11: 58,141,654	N775D	probably damaging	Het
Gli3	C	T	13: 15,613,850	H147Y	probably damaging	Het
Gm10754	G	T	10: 97,682,227		probably benign	Het
Gpr37	T	C	6: 25,669,138	D569G	probably damaging	Het
Grina	T	A	15: 76,249,089	Y286N	probably damaging	Het
Gtf3c1	C	A	7: 125,693,138		probably null	Het
Kcnc4	C	T	3: 107,448,218	V305M	probably benign	Het
Kntc1	T	C	5: 123,778,275	F724L	probably benign	Het
Kpnb1	T	C	11: 97,178,310	Y249C	probably damaging	Het
Krt6b	T	C	15: 101,678,374	T269A	probably benign	Het
Lamc1	T	C	1: 153,221,634	K1555E	probably damaging	Het
Maneal	T	C	4: 124,861,857	Y104C	probably damaging	Het
Mettl17	T	C	14: 51,890,703	L272P	probably benign	Het
Mib2	T	A	4: 155,656,999	S357C	probably benign	Het
Mmp19	C	A	10: 128,798,178	T316K	possibly damaging	Het
Mroh9	C	T	1: 163,026,509	G774E	probably damaging	Het
Myh1	T	C	11: 67,205,499		probably benign	Het
Ncor2	C	A	5: 125,027,138	E963*	probably null	Het
Nol6	T	A	4: 41,123,596	T51S	probably benign	Het
Nsun3	A	T	16: 62,735,369	C265S	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Nutm2	T	A	13: 50,469,481	N71K	probably damaging	Het
Olfr498	C	T	7: 108,465,960	T212I	probably benign	Het
Olfr713	T	G	7: 107,036,149	L5R	probably benign	Het
Orc3	T	A	4: 34,607,228	E34V	possibly damaging	Het
Pcdhb13	T	A	18: 37,442,836	L89Q	probably damaging	Het
Polr3a	A	T	14: 24,452,548	V1241E	probably null	Het
Prpf39	C	T	12: 65,053,314	P135S	probably damaging	Het
Psrc1	T	C	3: 108,384,993	V34A	probably benign	Het
Rab27a	G	A	9: 73,082,402	V52M	probably benign	Het
Rassf9	A	G	10: 102,546,034	T424A	probably benign	Het
Ripor3	G	T	2: 168,000,377	R61S	possibly damaging	Het
Ryr3	C	T	2: 112,636,522		probably benign	Het
Samd4b	C	T	7: 28,414,010	G177R	probably damaging	Het
Setbp1	C	T	18: 78,783,301	V1366M	probably benign	Het
Smad1	G	A	8: 79,343,730	A393V	probably benign	Het
Tctn2	T	C	5: 124,607,763		noncoding transcript	Het
Tmem45a	A	T	16: 56,811,602	F218I	possibly damaging	Het
Tpte	A	T	8: 22,355,471	R512S	probably damaging	Het
Trim37	T	A	11: 87,129,759	L22*	probably null	Het
Ttc6	A	G	12: 57,737,130	N1792D	probably damaging	Het
Ttn	A	G	2: 76,945,616	M1694T	probably damaging	Het
Vmn1r181	T	A	7: 23,984,712	W201R	probably damaging	Het
Wdr74	C	T	19: 8,738,228	L198F	possibly damaging	Het
Zfp560	T	C	9: 20,348,790	T259A	probably benign	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- AGGACATCTCTCTGGGAGGAACAAC -3'
(R):5'- TGTTTCAGACAAGTCAGCCACACC -3'

Sequencing Primer
(F):5'- CAACATCAGAGAGAGTGTCTTCCTG -3'
(R):5'- ACAGAAGTTGATGACTCCCTGTC -3'

Posted On

2014-03-28