Incidental Mutation 'R1481:Gcm1'
ID164381
Institutional Source Beutler Lab
Gene Symbol Gcm1
Ensembl Gene ENSMUSG00000023333
Gene Nameglial cells missing homolog 1
Synonymsglide, GCMa, Gcm a, Gcm 1, Gcm1-rs1, glial cell deficient
MMRRC Submission 039534-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1481 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location78051924-78065624 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 78059717 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 73 (K73*)
Ref Sequence ENSEMBL: ENSMUSP00000024104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024104]
PDB Structure
STRUCTURE OF THE GCM DOMAIN BOUND TO DNA [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000024104
AA Change: K73*
SMART Domains Protein: ENSMUSP00000024104
Gene: ENSMUSG00000023333
AA Change: K73*

DomainStartEndE-ValueType
Pfam:GCM 30 167 4.2e-75 PFAM
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein with a gcm-motif (glial cell missing motif). The encoded protein is a homolog of the Drosophila glial cells missing gene (gcm). This protein binds to the GCM-motif (A/G)CCCGCAT, a novel sequence among known targets of DNA-binding proteins. The N-terminal DNA-binding domain confers the unique DNA-binding activity of this protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired branching of the chorioallantoic interface, absence of the placental labyrinth, lack of fusion of chorionic trophoblast cells, and lethality between embryonic days 5.5-10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,008,434 V3365A probably damaging Het
Arhgef5 A G 6: 43,274,634 H773R probably damaging Het
Bmp3 G A 5: 98,872,470 V251M probably damaging Het
Ccdc175 C A 12: 72,101,948 probably benign Het
Ccdc178 C T 18: 22,105,621 G313D probably benign Het
Cd300ld2 T A 11: 115,012,633 I129F probably benign Het
Cep170 T C 1: 176,782,385 Q120R possibly damaging Het
Ckb T C 12: 111,671,262 H145R probably benign Het
Cntnap5a T A 1: 116,117,663 N336K probably damaging Het
Coil T A 11: 88,974,060 C38S possibly damaging Het
Cps1 T C 1: 67,143,882 V133A probably damaging Het
Cspg4 A G 9: 56,887,810 E943G probably damaging Het
Cyp2c54 C T 19: 40,047,588 D293N probably benign Het
Cyp2f2 T C 7: 27,121,877 S72P probably benign Het
Dip2c G A 13: 9,551,866 probably null Het
Dock6 T C 9: 21,820,622 T1158A probably benign Het
Dscaml1 G A 9: 45,672,643 V469I probably benign Het
Efcab14 A G 4: 115,756,517 T221A probably benign Het
Ehbp1 T C 11: 22,006,782 *1207W probably null Het
Eln T C 5: 134,706,572 K786E probably damaging Het
Fyb C T 15: 6,619,647 P385S probably benign Het
Galr1 A G 18: 82,405,741 I137T possibly damaging Het
Gemin5 T C 11: 58,141,654 N775D probably damaging Het
Gli3 C T 13: 15,613,850 H147Y probably damaging Het
Gm10754 G T 10: 97,682,227 probably benign Het
Gpr37 T C 6: 25,669,138 D569G probably damaging Het
Grina T A 15: 76,249,089 Y286N probably damaging Het
Gtf3c1 C A 7: 125,693,138 probably null Het
Kcnc4 C T 3: 107,448,218 V305M probably benign Het
Kntc1 T C 5: 123,778,275 F724L probably benign Het
Kpnb1 T C 11: 97,178,310 Y249C probably damaging Het
Krt6b T C 15: 101,678,374 T269A probably benign Het
Lamc1 T C 1: 153,221,634 K1555E probably damaging Het
Maneal T C 4: 124,861,857 Y104C probably damaging Het
Map1b T C 13: 99,431,171 T1681A unknown Het
Mettl17 T C 14: 51,890,703 L272P probably benign Het
Mib2 T A 4: 155,656,999 S357C probably benign Het
Mmp19 C A 10: 128,798,178 T316K possibly damaging Het
Mroh9 C T 1: 163,026,509 G774E probably damaging Het
Myh1 T C 11: 67,205,499 probably benign Het
Ncor2 C A 5: 125,027,138 E963* probably null Het
Nol6 T A 4: 41,123,596 T51S probably benign Het
Nsun3 A T 16: 62,735,369 C265S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Nutm2 T A 13: 50,469,481 N71K probably damaging Het
Olfr498 C T 7: 108,465,960 T212I probably benign Het
Olfr713 T G 7: 107,036,149 L5R probably benign Het
Orc3 T A 4: 34,607,228 E34V possibly damaging Het
Pcdhb13 T A 18: 37,442,836 L89Q probably damaging Het
Polr3a A T 14: 24,452,548 V1241E probably null Het
Prpf39 C T 12: 65,053,314 P135S probably damaging Het
Psrc1 T C 3: 108,384,993 V34A probably benign Het
Rab27a G A 9: 73,082,402 V52M probably benign Het
Rassf9 A G 10: 102,546,034 T424A probably benign Het
Ripor3 G T 2: 168,000,377 R61S possibly damaging Het
Ryr3 C T 2: 112,636,522 probably benign Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Setbp1 C T 18: 78,783,301 V1366M probably benign Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Tctn2 T C 5: 124,607,763 noncoding transcript Het
Tmem45a A T 16: 56,811,602 F218I possibly damaging Het
Tpte A T 8: 22,355,471 R512S probably damaging Het
Trim37 T A 11: 87,129,759 L22* probably null Het
Ttc6 A G 12: 57,737,130 N1792D probably damaging Het
Ttn A G 2: 76,945,616 M1694T probably damaging Het
Vmn1r181 T A 7: 23,984,712 W201R probably damaging Het
Wdr74 C T 19: 8,738,228 L198F possibly damaging Het
Zfp560 T C 9: 20,348,790 T259A probably benign Het
Other mutations in Gcm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Gcm1 APN 9 78065016 missense probably benign 0.09
IGL02132:Gcm1 APN 9 78064839 missense possibly damaging 0.95
IGL02820:Gcm1 APN 9 78064562 missense probably benign
IGL03074:Gcm1 APN 9 78064775 missense possibly damaging 0.84
PIT4280001:Gcm1 UTSW 9 78059633 missense probably damaging 1.00
R0720:Gcm1 UTSW 9 78064641 missense possibly damaging 0.68
R1271:Gcm1 UTSW 9 78059577 missense probably benign 0.05
R1421:Gcm1 UTSW 9 78059700 missense probably damaging 1.00
R1884:Gcm1 UTSW 9 78059579 missense probably benign 0.01
R1907:Gcm1 UTSW 9 78064773 missense probably benign 0.00
R2029:Gcm1 UTSW 9 78065044 missense possibly damaging 0.70
R2160:Gcm1 UTSW 9 78061380 missense probably benign 0.05
R3103:Gcm1 UTSW 9 78064452 missense probably damaging 0.98
R3944:Gcm1 UTSW 9 78059816 nonsense probably null
R5292:Gcm1 UTSW 9 78061426 missense probably damaging 1.00
R5769:Gcm1 UTSW 9 78064967 missense probably benign
R6446:Gcm1 UTSW 9 78059783 missense probably benign 0.08
R6465:Gcm1 UTSW 9 78064869 missense probably damaging 0.99
R7114:Gcm1 UTSW 9 78059779 missense probably damaging 1.00
R7212:Gcm1 UTSW 9 78059643 missense possibly damaging 0.84
R7398:Gcm1 UTSW 9 78064679 missense probably benign 0.00
R7584:Gcm1 UTSW 9 78064467 missense possibly damaging 0.62
R8130:Gcm1 UTSW 9 78064534 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCATAGATAGCACACACCTTGTCGC -3'
(R):5'- TAAACAGACTCTCGGTCTCCCTGG -3'

Sequencing Primer
(F):5'- catccaagaccatcagaaaacac -3'
(R):5'- GTCTCCCTGGCTGCCAC -3'
Posted On2014-03-28